Open Access
Open Peer Review

This article has Open Peer Review reports available.

How does Open Peer Review work?

Genetic variations of DICKKOPF family genes might not be associated with gastric cancer susceptibility

BMC GastroenterologyBMC series – open, inclusive and trusted201616:78

https://doi.org/10.1186/s12876-016-0489-1

Received: 5 February 2016

Accepted: 13 July 2016

Published: 26 July 2016

Abstract

Background

Recent studies have implicated that members of the DICKKOPF (DKK) were causally involved in large number of human cancers. This study was designed to investigate the relationship between the genetic variations of DKK family genes and the risk of gastric cancer (GC).

Methods

Six SNPs (single nucleotide polymorphisms) of DKK family genes, including rs2241529 in DKK1, rs3733635, rs17037102 and rs419764 in DKK2, rs3206824 in DKK3 and rs2073664 in DKK4, were selected and genotyped by restriction fragment length polymorphism (RFLP) and TaqMan SNP genotyping methods in 409 GC cases and 554 cancer-free controls in the Han population in eastern China.

Results

None of the six SNPs achieved significant association with the overall GC risk and stratified analysis by age, gender, smoking status, drinking status, tumor location and pathological classification confirmed these non-significant associations.

Conclusions

Our study indicated that the studied six SNPs of DKKs would not be the risk factors for GC in this Han Chinese population. Studies of larger population for different ethnicities will be needed to warrant our findings.

Keywords

Wnt signaling pathway Stomach neoplasms Single nucleotide polymorphism Epidemiology

Background

Based on GLOBOCAN estimates, about 951,600 new gastric cancer (GC) cases and 723,100 deaths occurred in 2012 worldwide [1]. In China, GC rate is predominately high and GC becomes the third fatal causes of caner, following lung cancer and liver cancer [2], which induces enormous burden on the society. The mechanism of gastric carcinogenesis is complex and it is well documented that environmental elements, including Helicobacter pylori (HP) infection and life styles, such as diet pattern, alcohol consumption and tobacco smoking, may contribute to the predisposition of GC [3]. Meanwhile, some other factors may play an important role in GC etiology, such as epigenetic and genetic effects [4]. Recently, associations between genetic variants and GC risk have been widely investigated [5, 6]. However, the results were not always consistent. Up to date, genetic factors for GC pathogenesis are still not fully interpreted.

As is well known, deregulation of Wnt/β-catenin pathway is a hallmark of major gastrointestinal cancers, including colorectal cancer and GC [7]. Several agonists and antagonists could modulate the Wnt/β-catenin pathway and were involved in the development and progression of malignant tumors. As a member of agonists and antagonists, the Dickkopfs (DKKs) were identified as a group of secreted Wnt modulators. The vertebrates express four DKK proteins (DKK1, -2, -3, and -4) [8]. The cysteine rich secreted protein products of the DKKs are antagonists of Wnt glycoproteins through binding to lipoprotein receptor-related protein 5/6 (LRP5/6) and Kremen, thus inducing LRP endocytosis and preventing signaling to β-catenin [9].

Several recent studies have implicated that members of the DKKs were causally involved in large number of human cancers including colorectal [10], melanoma [11], hepatocellular carcinoma [12], and GC [13]. In clinical GC specimens, DKK1 mRNA and protein expression levels were both reported to be significantly upregulated in GC lesions compared to adjacent noncancerous tissues [13]. Meanwhile, it would be a predictor of poor prognosis for GC patients [14].

The genetic variants of DKK family genes influencing the DKKs expressions on GC was not well elucidated. We hypothesized that variations of the corresponding DKKs, especially for those variants located in the gene functional region, may influence the mRNA and protein expression levels, and thus the predisposition of the disease. Therefore, we conducted a hospital-based case-control study to investigate the association between six potentially functional variants in DKKs and GC risk with 409 GC patients and 554 cancer-free healthy controls in a Chinese population.

Methods

Study subjects

In this study, 409 GC patients and 554 cancer-free healthy controls were recruited from the Jiangsu Provincial Hospital of Traditional Chinese Medicine (TCM) from January 2008 to July 2012. The patients were histo-pathologically confirmed primary GC. GC cases were classified into intestinal and diffuse subtype according to the Lauren’s criteria and those with mixed type or not available for classification were denoted unclassified. Gastric cardia cancers were defined as tumors located within 20 mm distal to the gastro-esophageal junction. The healthy controls were selected from the visitors of the health examination clinic of Jiangsu Provincial Hospital of TCM who came for an annual check-up during the same study period. The inclusion and exclusion criteria of the control subjects referred to the previous study [15]. Peripheral blood samples were obtained from the GC cases and healthy controls after the written informed consent was received from each subject. The study was approved by the Institutional Review Board of Jiangsu Provincial Hospital of TCM.

Genotyping of DKKs polymorphisms

Genomic DNA was extracted by AxyPrep-96 kit (Axygen, CA, USA) following the manufacturer’s instructions, and was quantified spectrophotometrically on NanoDrop2000 (Thermo Scientific, USA). From the public SNP database (http://www.ncbi.nlm.nih.gov/snp), 6 SNPs of the DKKs (rs2241529 in DKK1; rs3733635, rs17037102 and rs419764 in DKK2; rs3206824 in DKK3 and rs2073664 in DKK4) were selected as the candidate SNPs with minor allele frequency more than 10 % in the Han Chinese population. All the selected SNPs were located in the potentially functional region of the genes (5′UTR, exon, and 3′UTR), and the restriction fragment length polymorphism (RFLP) method was applied for genotyping the four SNPs rs3733635, rs17037102, rs3206824, and rs2073664. For those SNPs (SNPs rs419764 and rs2241529) with no proper restriction endonuclease, the commercially available predesigned TaqMan MGB probes and designed primers (Applied Biosystems, Foster City, CA, USA) were used for the genotyping. PCR reaction was conducted on the Veriti® 96-Well Thermal Cycler and the QuantStudio™ Dx Real-Time PCR Instrument (Applied Biosystems, Foster City, CA, USA), and the reaction condition can be referred to the previous study [16]. All the primers, enzymes and TaqMan SNP genotyping assay IDs are shown in Table 2.

Statistical analyses

The two sided χ2 test was applied to compare the genotype frequency of the DKKs variants between the GC cases and the controls. For the association analysis, the logistic regression analyses were employed to estimate the association between DKKs genotypes and risk of GC by computing the odds ratios (ORs) and 95 % confidence intervals (CIs), all the ORs were adjusted by age (continuous value) and sex (male = 0, female = 1). The common homozygote was selected as the reference for calculating the genotype specific ORs. Bonferroni correction was applied for multiple comparison. The Hardy-Weinberg equilibrium was tested by the χ2 test for goodness-of-fit and the p-value less than 0.05 was considered as the significant level. All the analyses were performed by the SAS 9.1.3 software (SAS Institute, Inc., Cary, NC, USA).

Results

Four hundred nine GC cases and 554 cancer-free healthy controls were enrolled in this study. The mean age for the cases and controls were 59.9 ± 11.2 and 53.5 ± 13.4 years, respectively. The proportion of male subjects was 70.9 % among the GC cases, and 64.4 % among the controls. Smokers accounted of 40.1 % among the GC cases, and 31.0 % among the healthy controls. Drinkers were 23.5 % among the GC cases, and 15.0 % in the healthy controls. Of the 409 GC cases, 292 (71.4 %) patients were classified as non-cardia GC and 106 (25.9 %) patients were classified as cardia GC according the tumor location. Meanwhile, 11 (2.7 %) cases cannot provide tumor location for the classification. For the GC cases, 383 (94.3 %) pathological tissues of each patient were available for the histological type dividing (72 diffuse GC cases and 311 intestinal GC cases) according to the Lauren’s classification. However, 26 (6.4 %) patients’ pathological tissues were not available for the classification (Table 1).
Table 1

Distributions of basic characteristics of GC cases and controls

Variables

Controls n = 554 (%)

Cases n = 409 (%)

P

Age

53.5 ± 13.4

59.9 ± 11.2

<0.001

Gender

  

0.035

 Male

357 (64.4)

290 (70.9)

 

 Female

197 (35.6)

119 (29.1)

 

Smoke

  

0.004

 No

382 (69.0)

245 (59.9)

 

 Yes

172 (31.0)

164 (40.1)

 

Drink

  

0.008

 No

471 (85.0)

313 (76.5)

 

 Yes

83 (15.0)

96 (23.5)

 

Tumor site

   

 Cadia

 

106 (25.9)

 

 Non-cardia

 

292 (71.4)

 

 Unclear

 

11 (2.7)

 

Pathological type

   

 Intestinal

 

311 (76.6)

 

 Diffuse

 

72 (17.7)

 

 Unclear

 

26 (6.4)

 
The genotype distribution of the six SNPs of DKKs among the GC cases and the controls is shown in Table 3. The observed genotype frequencies for all the SNPs were in Hardy-Weinberg equilibrium among the controls (P > 0.05) (Table 2). Allele frequencies of all the six SNPs (rs2241529, rs3733635, 17037102, 419764, 3206824 and rs2073664) among the GC and the controls demonstrated no significant difference (P = 0.42, 0.30, 0.81, 0.25, 0.99 and 0.94, respectively). None of the six SNPs achieved significant differences for the genotype distribution between GC cases and controls (P = 0.67 for rs2241529, 0.44 for rs3733635, 0.94 for 17037102, 0.28 for 419764, 0.90 for3206824 and 0.64 for rs2073664, respectively). Multiple logistic regression analysis revealed that none of the six SNPs in DKKs were associated with the overall GC risk (all P values > 0.05) (Table 3). The genetic effects of the six loci were further evaluated on the GC risk according to the confirmed histological type (intestinal and diffuse type), and the GA genotype of rs17037102 in DKK2 was found in association with an increased risk of diffuse GC with only marginal significance (adjusted OR = 1.77, 95 % CI: 1.01-3.11, P = 0.05). However, after Bonferroni correction, the P value reached no statistical significance (P = 0.14). GA genotype of rs17037102 was also not found in association with the intestinal GC (P = 0.42) (Table 4). Meanwhile, according to the site of tumor origin, it was not found any SNP was in association with the risk of either gastric non-cardia cancer or gastric cardia cancer (all P values >0.05) (Table 3).
Table 2

The genotyping methods for the SNPs of DKK family genes and Hardy-Weinberg equilibrium for control group

SNP ID

Gene

Assay method

Primers

Enzymes

PCR product Length

Alleles

Genotype and corresponding fragments length

Assay_ID

P*

rs2241529

DKK1

TaqMan

NA

NA

NA

NA

A > G

NA

C__15873446_20

0.28

rs419764

DKK2

TagMan

NA

NA

NA

NA

C > T

NA

C___2543897_10

0.23

rs3733635

DKK2

RFLP

Forward

ATTTCTGTCCTGAGGCGTGA

HinfI

170

T > C

TT (170) TC (170, 145, 25) CC (145,25)

NA

0.39

   

Reverse

TCCCCAGGAAGACGCAAAG

    

NA

 

rs17037102

DKK2

RFLP

Forward

TCTTAACCCCTCACATCCCG

DdeI

151

G > A

GG (117, 34) GA (117, 75, 42, 34) AA (75, 42, 34)

NA

0.88

   

Reverse

CCAGAACTACAGATATCCCTACC

    

NA

 

rs3206824

DKK3

RFLP

Forward

GGAGAGGAGCCTGACTGAAG

DdeI

232

G > A

242 (GG) GA (242, 203, 29) AA (203, 29)

NA

0.44

   

Reverse

ATGCACAACACCTCATGCTG

    

NA

 

rs2073664

DKK4

RFLP

Forward

GGTCCCATTCCCTTATCCCA

EcoNI

248

C > T

CC (181, 67) CT (248, 181, 67) TT (248)

NA

0.66

   

Reverse

CGCTGGAAGATTTCTGGAGC

    

NA

 

Abbreviations: NA not applicable

*P value for Hardy-Weinberg equilibrium of the studied genotypes in the controls

Table 3

The relationship between SNPs of DKK family genes and GC and subtype GC by tumor site

Genotypes

Controls

(N = 554)

Cases

(N = 409)

Adjusted OR (95 % CI)a

P

Cardia

(N = 106)

Adjusted OR (95 % CI)a

P

Non-Cardia

(N = 292)

Adjusted OR (95 % CI)a

P

 

n

%

n

%

    

n

%

    

n

%

    

rs2241529(DKK1)

                    

 AA

260

46.9 %

184

45.0 %

1.00

   

42

39.6 %

1.00

   

136

46.6 %

1.00

   

 AG

247

44.6 %

184

45.0 %

1.07

0.81

1.41

0.64

52

49.1 %

1.35

0.86

2.14

0.20

127

43.5 %

1.01

0.75

1.37

0.94

 GG

47

8.5 %

41

10.0 %

1.31

0.82

2.10

0.27

12

11.3 %

1.59

0.76

3.34

0.22

29

9.9 %

1.25

0.74

2.09

0.40

 AG + GG/AA

294

53.1 %

225

55.0 %

1.11

0.85

1.44

0.46

64

60.4 %

1.39

0.90

2.16

0.14

156

53.4 %

1.05

0.79

1.40

0.75

rs3733635(DKK2)

                    

 TT

335

60.5 %

238

58.2 %

1.00

   

61

57.5 %

1.00

   

169

57.9 %

1.00

   

 TC

196

35.4 %

147

35.9 %

1.11

0.84

1.47

0.46

40

37.7 %

1.26

0.80

1.98

0.32

105

36.0 %

1.11

0.82

1.51

0.49

 CC

23

4.2 %

24

5.9 %

1.40

0.76

2.59

0.28

5

4.7 %

1.40

0.49

4.02

0.53

18

6.2 %

1.45

0.75

2.79

0.27

 TC + CC/AA

219

39.5 %

171

41.8 %

1.14

0.88

1.49

0.33

45

42.5 %

1.28

0.82

1.98

0.28

123

42.1 %

1.15

0.86

1.54

0.35

rs17037102(DKK2)

                    

 GG

214

38.6 %

157

38.4 %

1.00

   

39

36.8 %

1.00

   

114

39.0 %

1.00

   

 GA

262

47.3 %

191

46.7 %

0.98

0.74

1.31

0.91

50

47.2 %

1.04

0.65

1.67

0.87

135

46.2 %

0.96

0.70

1.31

0.78

 AA

78

14.1 %

61

14.9 %

1.08

0.72

1.62

0.70

17

16.0 %

1.30

0.68

2.50

0.42

43

14.7 %

1.04

0.67

1.62

0.85

 GA + AA/GG

340

61.4 %

252

61.6 %

1.01

0.77

1.32

0.97

67

63.2 %

1.10

0.70

1.71

0.69

178

61.0 %

0.98

0.73

1.31

0.88

rs419764(DKK2)

                    

 CC

304

54.9 %

244

59.7 %

1.00

   

61

57.5 %

1.00

   

176

60.3 %

1.00

   

 CT

220

39.7 %

142

34.7 %

0.80

0.61

1.06

0.11

38

35.8 %

0.88

0.56

1.39

0.58

100

34.2 %

0.79

0.58

1.07

0.13

 TT

30

5.4 %

23

5.6 %

0.94

0.52

1.68

0.83

7

6.6 %

1.10

0.45

2.71

0.83

16

5.5 %

0.89

0.47

1.70

0.72

 CT + TT

250

45.1 %

165

40.3 %

0.82

0.63

1.06

0.13

45

42.5 %

0.91

0.59

1.40

0.66

116

39.7 %

0.80

0.60

1.08

0.14

rs3206824(DKK3)

                    

 GG

340

61.4 %

249

60.9 %

1.00

   

60

56.6 %

1.00

   

182

62.3 %

1.00

   

 GA

184

33.2 %

140

34.2 %

1.06

0.80

1.40

0.69

41

38.7 %

1.34

0.85

2.11

0.20

96

32.9 %

0.98

0.72

1.34

0.92

 AA

30

5.4 %

20

4.9 %

0.94

0.51

1.72

0.84

5

4.7 %

0.87

0.31

2.38

0.78

14

4.8 %

0.89

0.46

1.74

0.73

 GA + AA/GG

214

38.6 %

160

39.1 %

1.04

0.80

1.36

0.76

46

43.4 %

1.27

0.82

1.96

0.29

110

37.7 %

0.97

0.72

1.31

0.85

rs2073664(DKK4)

                    

 CC

444

80.1 %

331

80.9 %

1.00

   

85

80.2 %

1.00

   

236

80.8 %

1.00

   

 CT

105

19.0 %

72

17.6 %

0.91

0.64

1.27

0.56

18

17.0 %

0.82

0.46

1.44

0.49

53

18.2 %

0.93

0.64

1.35

0.71

 TT

5

0.9 %

6

1.5 %

1.39

0.41

4.74

0.60

3

2.8 %

2.92

0.62

13.73

0.17

3

1.0 %

0.91

0.21

3.89

0.89

 CT + TT/CC

110

19.9 %

78

19.1 %

0.93

0.67

1.29

0.66

21

19.8 %

0.91

0.53

1.56

0.73

56

19.2 %

0.93

0.65

1.34

0.70

aORs were adjusted by age and gender

Table 4

The association between SNPs of DKK family genes and the pathological subtype GC cases

Genotypes

Controls

(N = 554)

Intestinal

(N = 311)

Adjusted OR (95 % CI)a

P

Diffuse

(N = 72)

Adjusted OR (95 % CI)a

P

 

n

%

n

%

    

n

%

    

rs2241529(DKK1)

              

 AA

260

46.9 %

141

45.3 %

1.00

   

29

40.3 %

1.00

   

 AG

247

44.6 %

142

45.7 %

1.10

0.82

1.49

0.52

34

47.2 %

1.25

0.73

2.11

0.42

 GG

47

8.5 %

28

9.0 %

1.10

0.65

1.87

0.72

9

12.5 %

1.75

0.78

3.96

0.18

 AG + GG/AA

294

53.1 %

170

54.7 %

1.10

0.83

1.47

0.51

43

59.7 %

1.33

0.80

2.19

0.27

rs3733635(DKK2)

              

 TT

335

60.5 %

190

61.1 %

1.00

   

38

52.8 %

1.00

   

 TC

196

35.4 %

100

32.2 %

0.98

0.72

1.34

0.91

32

44.4 %

1.48

0.89

2.45

0.13

 CC

23

4.2 %

21

6.8 %

1.58

0.84

3.00

0.16

2

2.8 %

0.77

0.17

3.39

0.73

 TC + CC/AA

219

39.5 %

121

38.9 %

1.05

0.78

1.41

0.75

34

47.2 %

1.40

0.85

2.30

0.18

rs17037102(DKK2)

              

 GG

214

38.6 %

124

39.9 %

1.00

   

20

27.8 %

1.00

   

 GA

262

47.3 %

139

44.7 %

0.88

0.64

1.20

0.42

43

59.7 %

1.77

1.01

3.11

0.05*

 AA

78

14.1 %

48

15.4 %

1.08

0.70

1.66

0.74

9

12.5 %

1.27

0.55

2.92

0.57

 GA + AA/GG

340

61.4 %

187

60.1 %

0.92

0.69

1.24

0.59

52

72.2 %

1.66

0.96

2.86

0.07

rs419764(DKK2)

              

 CC

304

54.9 %

179

57.6 %

1.00

   

48

66.7 %

1.00

   

 CT

220

39.7 %

112

36.0 %

0.87

0.64

1.18

0.36

23

31.9 %

0.66

0.39

1.12

0.13

 TT

30

5.4 %

20

6.4 %

1.14

0.61

2.10

0.69

1

1.4 %

0.20

0.03

1.48

0.11

 CT + TT

250

45.1 %

132

42.4 %

0.90

0.68

1.20

0.48

24

33.3 %

0.60

0.36

1.02

0.06

rs3206824(DKK3)

              

 GG

340

61.4 %

193

62.1 %

1.00

   

38

52.8 %

1.00

   

 GA

184

33.2 %

103

33.1 %

0.99

0.73

1.35

0.97

29

40.3 %

1.43

0.85

2.41

0.17

 AA

30

5.4 %

15

4.8 %

0.87

0.45

1.69

0.68

5

6.9 %

1.47

0.54

4.04

0.45

 GA + AA/GG

214

38.6 %

118

37.9 %

0.98

0.73

1.31

0.87

34

47.2 %

1.44

0.88

2.36

0.15

rs2073664(DKK4)

              

 CC

444

80.1 %

252

81.0 %

1.00

   

60

83.3 %

1.00

   

 CT

105

19.0 %

54

17.4 %

0.88

0.60

1.28

0.49

11

15.3 %

0.76

0.39

1.50

0.43

 TT

5

0.9 %

5

1.6 %

1.55

0.43

5.62

0.50

1

1.4 %

1.30

0.15

11.48

0.81

 CT + TT/CC

110

19.9 %

59

19.0 %

0.91

0.63

1.31

0.61

12

16.7 %

0.79

0.41

1.52

0.47

*P value reached no statistical significance by Bonferroni correction

aORs were adjusted by age and gender

Discussion

In this study, rs2241529 in DKK1, rs3733635, rs17037102 and rs419764 in DKK2, rs3206824 in DKK3, and rs2073664 in DKK4 were analyzed among 409 pathologically confirmed GC patients and 554 healthy controls. The relationship between these SNPs and clinic pathologic data, including pathological subtype (intestinal and diffuse) and tumor original site (gastric cardia and non-cardia cancer) was analyzed. Our results showed an insignificant association, as well as among a series subgroup analysis and this is the first study to assess these six variants of DKK family genes on the risk of GC.

DKKs are known as antagonists of Wnt glycoproteins through binding to lipoprotein LRP5/6 and Kremen, thus inducing LRP endocytosis and preventing the signaling to β-catenin [9]. Human DKKs have been implicated in several kinds of malignant tumors. For instance, DKK1 protein was predominantly elevated in tissues of hepatocellular carcinoma [12], non-small cell lung cancer [17] and chondrosarcoma [18]. For GC, DKK1 protein was also expressed higher in malignancy than benign tissues [14] and could refer to poor prognosis [13]. DKK2 protein was seen overexpressed in Ewing sarcoma [19], colorectal cancer [10] and reduce in melanoma [11]. It may function as a tumor suppressor or tumor activator depending on the circumstance. DKK3 and DKK4 could be referred as the putative tumor suppressors. Tumor suppression role of DKK3 protein was found in human cancers in ovary [20], cervix [21] and colon [22]; and expression of DKK4 protein was reduced in hepatocellular carcinoma tissue and could decrease the β-catenin protein levels [12].

Variation of the corresponding DKKs, especially in the potentially functional regions, may influence the mRNA and protein expression, and thus the risk of tumors. A small case-control study (210 renal patients vs. 200 controls) reported GA/AA genotype of rs3206824 in DKK3 and GG genotype of rs17037102 in DKK2 were related with decreased risk of renal cancer and cancer deaths, respectively, in Japanese population [23]. However, our study did not reappear such an association in GC risk in Chinese population. The results suggest a considerable heterogeneous effect of these two SNPs among various cancer types and/or different genetic backgrounds. Alanazi et al., [24] reported 2-fold reduced breast cancer risk in women with GG genotype as compared to AA genotype in case of rs6485350 in DKK3 [24]. Furthermore, GG genotype and AG genotype showed enhanced protection against estrogen receptor positive tumor and estrogen receptor negative tumor, respectively. SNP rs3763511 in DKK4 was related with age independent increased breast cancer risk of estrogen receptor negative tumor. Despite the significant findings, two loci located in the introns in the corresponding gene and beyond our selection range. The significant association could be explained by the linkage disequilibrium with the potentially functional loci, or the observed association may be due to chance with small sample size (99 patients vs. 93 controls).

Several limitations of the present study need to be mentioned. First, the mean age in the GC cases was significantly higher than that of the healthy controls, and the age itself may be an independent risk element for GC. However, all the odds ratio of six SNPs was adjusted by age and gender to minimize the potential confounding effect. Second, environmental factors, such as H. pylori infection was not considered in this study, which may demonstrate the non-genetic factors on the risk of GC, and further explain the gene-environmental interaction on GC. Further studies with large sample size are warranted to evaluate the contribution of gene-environment interaction on GC.

Conclusions

Our study indicated that the studied six SNPs of DKKs would not be the risk factors for GC in this Han Chinese population. However, analysis of these SNPs incorporating with environmental factors may further explain the risk on GC.

Abbreviations

CI, confidence interval; DKK, DICKKOPF; GC, gastric cancer; LRP5/6, lipoprotein receptor-related protein 5/6; OR, odds ratio; RFLP, restriction fragment length polymorphism; SNP, single nucleotide polymorphism; TCM, traditional Chinese medicine.

Declarations

Acknowledgements

Not applicable.

Funding

This work was supported by Science Foundation for Youth of Nanjing University of Traditional Chinese Medicine (13XZR04), Natural Science Foundation of the Jiangsu Higher Education institutions of China (14KJD330001), Research and innovation program of graduate students in Jiangsu Higher Education institution(CXLX13_576), and National Natural Science Foundation of China (81473458 and 81473593).

Availability of data and materials

The datasets during and/or analysed during the current study available from the corresponding author on reasonable request.

Authors’ contributions

JW and ZL conceived and designed the study and JW wrote the manuscript; JFZ and ZZ conducted the genotyping and helped in the data analysis; QHC collected the samples and data. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

The study was approved by the Institutional Review Board of Jiangsu Provincial Hospital of Traditional Chinese Medicine, and written informed consent was received from each participant before the study.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Nutrition and Food Hygiene, Key Laboratory of Modern Toxicology, Ministry of Education, School of Public Health, Nanjing Medical University
(2)
Discipline of Chinese and Western Integrative Medicine, Nanjing University of Chinese Medicine
(3)
Department of Digestive Tumor Surgery, Jiangsu Province Hospital of Traditional Chinese Medicine, Affiliated Hospital of Nanjing University of Traditional Chinese Medicine

References

  1. Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer statistics, 2012. CA Cancer J Clin. 2015;65(2):87–108.View ArticlePubMedGoogle Scholar
  2. Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, et al. Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer. 2015;136(5):E359–86.View ArticlePubMedGoogle Scholar
  3. Woo HD, Lee J, Choi IJ, Kim CG, Lee JY, Kwon O, et al. Dietary flavonoids and gastric cancer risk in a Korean population. Nutrients. 2014;6(11):4961–73.View ArticlePubMedPubMed CentralGoogle Scholar
  4. Shi Y, Hu Z, Wu C, Dai J, Li H, Dong J, et al. A genome-wide association study identifies new susceptibility loci for non-cardia gastric cancer at 3q13.31 and 5p13.1. Nat Genet. 2011;43(12):1215–8.View ArticlePubMedGoogle Scholar
  5. Luo D, Gao Y, Wang S, Wang M, Wu D, Wang W, et al. Genetic variation in PLCE1 is associated with gastric cancer survival in a Chinese population. J Gastroenterol. 2011;46(11):1260–6.View ArticlePubMedGoogle Scholar
  6. Zhang H, Jin G, Li H, Ren C, Ding Y, Zhang Q, et al. Genetic variants at 1q22 and 10q23 reproducibly associated with gastric cancer susceptibility in a Chinese population. Carcinogenesis. 2011;32(6):848–52.View ArticlePubMedPubMed CentralGoogle Scholar
  7. Ara H, Takagishi M, Enomoto A, Asai M, Ushida K, Asai N, et al. A role for Daple in non-canonical Wnt signaling during gastric cancer invasion and metastasis. Cancer Sci. 2016;107(2):133–9Google Scholar
  8. Niehrs C. Function and biological roles of the Dickkopf family of Wnt modulators. Oncogene. 2006;25(57):7469–81.View ArticlePubMedGoogle Scholar
  9. Giles RH, van Es JH, Clevers H. Caught up in a Wnt storm: Wnt signaling in cancer. Biochim Biophys Acta. 2003;1653(1):1–24.PubMedGoogle Scholar
  10. Matsui A, Yamaguchi T, Maekawa S, Miyazaki C, Takano S, Uetake T, et al. DICKKOPF-4 and -2 genes are upregulated in human colorectal cancer. Cancer Sci. 2009;100(10):1923–30.View ArticlePubMedGoogle Scholar
  11. Kuphal S, Lodermeyer S, Bataille F, Schuierer M, Hoang BH, Bosserhoff AK. Expression of Dickkopf genes is strongly reduced in malignant melanoma. Oncogene. 2006;25(36):5027–36.View ArticlePubMedGoogle Scholar
  12. Fatima S, Lee NP, Tsang FH, Kolligs FT, Ng IO, Poon RT, et al. Dickkopf 4 (DKK4) acts on Wnt/beta-catenin pathway by influencing beta-catenin in hepatocellular carcinoma. Oncogene. 2012;31(38):4233–44.View ArticlePubMedGoogle Scholar
  13. Gao C, Xie R, Ren C, Yang X. Dickkopf-1 expression is a novel prognostic marker for gastric cancer. J Biomed Biotechnol. 2012;2012:804592.PubMedPubMed CentralGoogle Scholar
  14. Lee HS, Lee HE, Park do J, Kim HH, Kim WH, Park KU. Clinical significance of serum and tissue Dickkopf-1 levels in patients with gastric cancer. Clin Chim Acta. 2012;413(21-22):1753–60.View ArticlePubMedGoogle Scholar
  15. Zhan Z, Wu J, Zhang JF, Yang YP, Tong S, Zhang CB, et al. CDH1 gene polymorphisms, plasma CDH1 levels and risk of gastric cancer in a Chinese population. Mol Biol Rep. 2012;39(8):8107–13.View ArticlePubMedGoogle Scholar
  16. Wu J, Lu Y, Ding YB, Ke Q, Hu ZB, Yan ZG, et al. Promoter polymorphisms of IL2, IL4, and risk of gastric cancer in a high-risk Chinese population. Mol Carcinog. 2009;48(7):626–32.View ArticlePubMedGoogle Scholar
  17. Li S, Qin X, Guo X, Cui A, He Y, Wei S, et al. Dickkopf-1 is oncogenic and involved in invasive growth in non small cell lung cancer. PLoS One. 2013;8(12), e84944.View ArticlePubMedPubMed CentralGoogle Scholar
  18. Chen C, Zhou H, Zhang X, Ma X, Liu Z, Liu X. Elevated levels of Dickkopf-1 are associated with beta-catenin accumulation and poor prognosis in patients with chondrosarcoma. PLoS One. 2014;9(8), e105414.View ArticlePubMedPubMed CentralGoogle Scholar
  19. Hauer K, Calzada-Wack J, Steiger K, Grunewald TG, Baumhoer D, Plehm S, et al. DKK2 mediates osteolysis, invasiveness, and metastatic spread in Ewing sarcoma. Cancer Res. 2013;73(2):967–77.View ArticlePubMedGoogle Scholar
  20. You A, Fokas E, Wang LF, He H, Kleb B, Niederacher D, et al. Expression of the Wnt antagonist DKK3 is frequently suppressed in sporadic epithelial ovarian cancer. J Cancer Res Clin Oncol. 2011;137(4):621–7.View ArticlePubMedGoogle Scholar
  21. Lee EJ, Jo M, Rho SB, Park K, Yoo YN, Park J, et al. Dkk3, downregulated in cervical cancer, functions as a negative regulator of beta-catenin. Int J Cancer. 2009;124(2):287–97.View ArticlePubMedGoogle Scholar
  22. Baehs S, Herbst A, Thieme SE, Perschl C, Behrens A, Scheel S, et al. Dickkopf-4 is frequently down-regulated and inhibits growth of colorectal cancer cells. Cancer Lett. 2009;276(2):152–9.View ArticlePubMedGoogle Scholar
  23. Hirata H, Hinoda Y, Nakajima K, Kikuno N, Yamamura S, Kawakami K, et al. Wnt antagonist gene polymorphisms and renal cancer. Cancer. 2009;115(19):4488–503.View ArticlePubMedPubMed CentralGoogle Scholar
  24. Alanazi MS, Parine NR, Shaik JP, Alabdulkarim HA, Ajaj SA, Khan Z. Association of single nucleotide polymorphisms in Wnt signaling pathway genes with breast cancer in Saudi patients. PLoS One. 2013;8(3), e59555.View ArticlePubMedPubMed CentralGoogle Scholar

Copyright

© The Author(s). 2016