Skip to main content

Table 2 The genotyping methods for the SNPs of DKK family genes and Hardy-Weinberg equilibrium for control group

From: Genetic variations of DICKKOPF family genes might not be associated with gastric cancer susceptibility

SNP ID Gene Assay method Primers Enzymes PCR product Length Alleles Genotype and corresponding fragments length Assay_ID P*
rs2241529 DKK1 TaqMan NA NA NA NA A > G NA C__15873446_20 0.28
rs419764 DKK2 TagMan NA NA NA NA C > T NA C___2543897_10 0.23
rs3733635 DKK2 RFLP Forward ATTTCTGTCCTGAGGCGTGA HinfI 170 T > C TT (170) TC (170, 145, 25) CC (145,25) NA 0.39
    Reverse TCCCCAGGAAGACGCAAAG      NA  
rs17037102 DKK2 RFLP Forward TCTTAACCCCTCACATCCCG DdeI 151 G > A GG (117, 34) GA (117, 75, 42, 34) AA (75, 42, 34) NA 0.88
    Reverse CCAGAACTACAGATATCCCTACC      NA  
rs3206824 DKK3 RFLP Forward GGAGAGGAGCCTGACTGAAG DdeI 232 G > A 242 (GG) GA (242, 203, 29) AA (203, 29) NA 0.44
    Reverse ATGCACAACACCTCATGCTG      NA  
rs2073664 DKK4 RFLP Forward GGTCCCATTCCCTTATCCCA EcoNI 248 C > T CC (181, 67) CT (248, 181, 67) TT (248) NA 0.66
    Reverse CGCTGGAAGATTTCTGGAGC      NA  
  1. Abbreviations: NA not applicable
  2. *P value for Hardy-Weinberg equilibrium of the studied genotypes in the controls
\