Skip to main content
Download PDF

RFC2 promotes aerobic glycolysis and progression of colorectal cancer

BMC Gastroenterology volume 23, Article number: 353 (2023) Cite this article

Abstract

Background

Replication factor C subunit 2 (RFC2) participates in the growth and metastasis of various malignancies. Our study investigated the roles of RFC2 in colorectal cancer (CRC).

Results

RFC2 expression was upregulated in CRC tissues and cells. High RFC2 expression was associated with poor prognosis. Knockdown RFC2 inhibited proliferation, induced apoptosis, and suppressed migration and invasion of CRC cells. CREB5 was a transcription factor of RFC2, and CREB5 knockdown suppressed RFC2 expression. Furthermore, RFC2 promoted aerobic glycolysis and MET/PI3K/AKT/mTOR pathway.

Conclusion

RFC2 promoted the progression of CRC cells via activating aerobic glycolysis and the MET/PI3K/AKT/mTOR pathway.

Peer Review reports

Introduction

Colorectal cancer (CRC) is a leading cause of cancer-related death worldwide [1]. China accounts for 28.8% of the world’s diagnosed cases of CRC in 2020 [2]. CRC screening has been widely used in a large number of countries [3]. However, the participation rate of colonoscopy screening remains low in China [4]. A study showed that CRC cases with distant metastasis account for 25% [5]. Great progress has been made in surgical technique and adjuvant therapy, however, the five-year survival rate is not satisfactory in CRC patients with distant metastasis [6,7,8]. Therefore, investigating effective biomarkers and therapeutics of CRC is conducive to better treatment of CRC.

Replicate factor C (RFC) is a primer recognition factor of DNA polymerase, which is reported to participate in DNA replication and repair [9]. The RFC family possess five subunits (RFC1-5), those aberrantly expressed in a variety of malignant tumors [10]. RFC3 induces EMT, invasion, and migration of lung adenocarcinoma cells though the Wnt/β-catenin pathway [11]. RFC4 promotes metastasis and stemness by activating Notch1 signaling in non-small-cell lung cancer [12]. RFC5 might be an oncogene and prognostic biomarker of lung cancer [13]. RFC3 mutation and loss of RFC3 expression occur in large fractions of gastric cancer and CRC [14]. RFC4 is frequently overexpressed in CRC, and is associated with tumor progression and worse survival outcome [15]. RFC4 is identified as a radioresistance factor that promotes NHEJ-mediated DNA repair in CRC cells [16]. circ_0038985/miR-3614-5p RFC5 promotes the progression of CRC [17]. RFC2 promotes diffuse lower-grade gliomas progression and correlates with the immune infiltration of lower-grade gliomas [18]. RFC2 plays an oncogenic role in progression of hepatocellular carcinoma by regulating DNA replication and cell cycle [19]. RFC2 promotes cell cycle arrest and its expression is inhibited by miR-744 in CRC [20]. RFC2 is up-regulated in nasopharyngeal carcinoma and might be a candidate molecular marker [21]. Nonetheless, the underline mechanism of RFC2 in CRC is not fully investigated.

CREB5, a transcription factor (TF), interacts with the promoter of genes, and promotes the progression of cancers [22, 23]. Our previous research has shown that CREB5 is increased in CRC tissues and cells, and lncRNA SNHG5/miR-132-3p/CREB5 makes for malignant development of CRC cells [24]. However, the regulatory mechanism of CREB5 in CRC is still unclear.

In this study, we explored the expression and prognostic value of RFC2 in CRC. We sought to investigate the underlying mechanisms of RFC2 in CRC.

Material and methods

Bioinformatics analysis

Two hundred seventy-five colon adenocarcinoma and 349 normal tissues were collected from TCGA-COAD dataset (http://gepia2.cancer-pku.cn/#index). The survival analysis of RFC2 expression in patients with CRC was analyzed using Kmplot (http://kmplot.com/analysis/). RFC2 expression was performed gene set enrichment analysis (GSEA) using R package.

Tissue collection and IHC

Eight pairs of cancer and matched normal tissues were collected from patients at The Second Hospital of Shandong University from January 2021 to December 2021. 50 CRC tumor tissues were collected at The Second Hospital of Shandong University from January 2016 to December 2021. The protocol of this research has been approved by the Ethics Committee of The Second Hospital of Shandong University. Written informed consent was obtained from all patients. The sections of tissues were incubated with an RFC2 antibody (Abcam, 1:200, ab251796).

Cell culture

Normal human colonic epithelial cells (FHC) and five human CRC cell lines (HCT116, LoVo, SW480, Caco-2, and DLD-1) were purchased from Nanjing Cobioer Biotechnology Co., LTD. FHC cells were cultured in DMEM/F12 (HyClone, USA) containing 10% fetal bovine serum (FBS), cholera toxin (10 ng/ml), insulin (0.005 mg/ml), transferrin (0.005 mg/ml), hydrocortisone (100 ng/ml), and human recombinant EGF (20 ng/ml). HCT116 cells were cultured in McCoy's 5a containing 10% FBS. DLD-1 cells were cultured in 1640 containing 10% FBS. LoVo and SW480 cells were cultured in DMEM containing 10% FBS. Caco-2 cells were cultured in MEM containing 20% FBS. All cell lines were maintained in a humidified chamber containing 5% CO2 at 37 °C.

Cell transfection

The overexpression plasmid of RFC2 and CREB5 (oe-RFC2 and oe-CREB5), small interfering RNA of RFC2 and CREB5 (si-RFC2 and si-CREB5), and their negative controls were obtained from GenePharma (Shanghai, China). Lipofectamineâ„¢ 3000 (Invitrogen) was used for above plasmids transfection.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

The TRIzol RNA reagent (Invitrogen, Carlsbad, CA) was used to extract RNA from cells. The HiScript II Q Select RT SuperMix (Vazyme, China) was employed to make cDNA. SYBR green (Takara Biotechnology Co., Ltd.) was employed to real-time PCR analysis. RT-qPCR was performed using an ABI StepOnePlus real-time PCR system (Applied Biosystems). The expression of RFC2 was determined by 2−ΔΔCt method. RFC2, forward primer: CTACGAACTGCCGTGGGTT, reverse primer: GAGGGCCCGCAATGATGATG. β-actin, forward primer: AACACCCCAGCCATGTACGTT, reverse primer: CCATCTCTTGCTCGAAGTCCA.

Cell viability

Cells (2 × 104 cells/well) were seeded in 96-well plates. At 0, 48, and 72 h, 10 µl of CCK-8 reagent (Beyotime, Shanghai, China) was added to each well for 2 h. The absorbance of each well was measured at 450 nm using a microplate reader (Bio-Rad, Hercules, CA, USA).

Apoptosis assay

Cells were suspended in buffer and stained with FITC Annexin V Apoptosis Detection Kit (Beyotime) in dark place for 10 min. Apoptosis was measured using flow cytometry (BD Biosciences).

Wound healing and invasion assays

For wound healing assays, until 95% of the cells covered the 6-well plate, wound was produced by scratching the cell monolayer with 10 μl pipette tips. Wound images were taken with a microscope at 0 and 24 h. For invasion assays, Matrigel (BD Biosciences) was added to the upper chamber. Cells were shifted to the upper chamber, while medium containing 10% FBS was added to the lower chamber. After 24 h, cells were stained with crystal violet solution for 2 h. The pictures were taken under a microscope (Olympus, Tokyo, Japan).

Chromatin immunoprecipitation (ChIP) assay

The assay was performed using ChIP Assay Kit (Beyotime, China). Chromatin was immunoprecipitated using polymerase II, CREB5, or IgG antibody. RFC2 expression was evaluated using RT-qPCR.

Dual-luciferase assay

Wild type (wt) and mutant type (mut) promoter region of RFC2 were cloned into pGL3-report vector (GenePharma). HEK-293 T cells were co-transfected with RFC2-wt, RFC2-mut, ov-CREB5, or ov-NC plasmids using Lipofectamine™ 3000 (Invitrogen). To examine luciferase activity, dual-luciferase reporter assay system (Promega) was used at 24 h post-transfection.

Western blot

Cells were lysed in RIPA, and protein concentration was detected by a BCA Kit (Beyotime). Proteins were separated by SDS-PAGE and further transferred onto PVDF membranes (Millipore, MA, USA). Membranes were incubated overnight at 4 °C with RFC2 (Abcam, 1:1000, ab251796), CRBB5 (Abcam, 1:1000, ab168928), LDHA (Abclonal, 1:1000, A1146), GLUT1 (Abcam, 1:1000, ab115730), HK2 (Abclonal, 1:1000, A0994), p-PI3K (Abcam, 1:1000, ab182651), PI3K (Abcam, 1:1000, ab191606), p-AKTSer473 (Cell Signaling Technology (CST), 1:1000, 4060), AKT (Proteintech, 1:1000, 10,176–2-AP), p-mTOR (Abcam, 1:1000, ab109268), mTOR (Proteintech, 1:1000, 28,273–1-AP), p-70S6K (CST, 1:1000, 9205), 70S6K (CST, 1:1000, 9202), MET (Proteintech, 1:1000, 25,869–1-AP), and β-actin antibody (Proteintech, 1:10,000, 20,536–1-AP). Membranes were incubated with secondary antibody (Abcam, 1:10,000, ab6721). The proteins were detected using a GEL imaging system (Bio-Rad, CA, USA).

Glucose uptake and lactate production

Glucose uptake and lactate production were determined in the supernatants from the cells according to the protocols of Glucose Uptake Assay Kit and Lactate Assay Kit (Abcam, USA).

Statistical analysis

GraphPad Prism 8.0 software was used to conduct statistical analyses. The differences among groups were analyzed using the student’s t-test or one-way ANOVA. p < 0.05 was defined as statistically significant.

Results

RFC2 is upregulated in CRC tissues

RFC2 expression was analyzed using TCGA dataset. RFC2 was upregulated in CRC tissues compared with normal tissues (Fig. 1A). Higher expression of RFC2 (p = 0.033) was found to related with a poor prognosis of CRC (Fig. 1B). RFC2 protein in CRC tissues was higher than that in the matched normal tissues (Fig. 1C and D). RFC2 protein expression was also evaluated in 50 CRC patients by IHC (Fig. 1E). Kaplan–Meier analysis revealed that high RFC2 expression in CRC was correlated with poor overall survival (Fig. 1F). Compared with that in normal human colonic epithelial cells (FHC), RFC2 was highly expressed in CRC cell lines (DLD-1, HCT116, LoVo, Caco-2, and SW480) (Fig. 1G). RFC2 expression was particularly high in HCT116 and SW480 cells, compared with other cell lines. We selected HCT116 and SW480 cells to further investigate the roles of RFC2 in CRC.

Fig. 1
figure 1

RFC2 is upregulated in CRC tissues. A Expression of RFC2 in TCGA-COAD datasets. B Overall survival of patients with CRC in TCGA-COAD datasets, who were divided into high or low RFC2 expression. C and D RFC2 protein expressions in CRC and matched normal tissues were measured using IHC and western blot. E RFC2 protein expression in 50 CRC tissues was assessed by IHC. F Kaplan–Meier survival curve of overall survival. G RFC2 protein levels were detected in normal human colonic epithelial cells (FHC) and five human CRC cell lines (HCT116, LoVo, SW480, Caco-2, and DLD-1). *p < 0.05 vs. Normal or FHC group

Full size image

RFC2 promotes proliferation, migration, and invasion of CRC cells

si-RFC2 and oe-RFC2 were transfected in HCT116 and SW480 cells. The efficacy was validated using RT-qPCR and western blot (Fig. 2A). Silencing of RFC2 dramatically decreased cell viability, whereas, overexpression of RFC2 promoted cell viability (Fig. 2B). RFC2-knockdown considerably induced apoptosis, while, RFC2-overexpression reduced apoptosis (Fig. 2C). RFC2 knockdown dramatically decreased migration and invasion abilities of HCT116 and SW480 cells (Fig. 2D and E). In contrast, RFC2 overexpression promoted migration and invasion in HCT116 and SW480 cells (Fig. 2D and E).

Fig. 2
figure 2

RFC2 promotes proliferation, migration, and invasion of CRC cells. A RFC2 mRNA and protein expressions were determined in HCT116 and SW480 cells. B Cell viability was examined using CCK-8 assay. C Apoptosis was detected using flow cytometry. D Wound healing assay was conducted in HCT116 and SW480 cells. E Transwell assay was performed in HCT116 and SW480 cells. *p < 0.05 vs. si-NC or Vector group

Full size image

CREB5 regulates RFC2 transcriptional activity

A sketch map of RFC2 promoter region was shown in Fig. 3A. We performed a luciferase activity assay using HEK-293 T cells to verify the binding of CREB5 in the RFC2 promoter region. CREB5 overexpression increased RFC2 transcriptional activity (Fig. 3B). ChIP assay results demonstrated that CREB5 interacted with RFC2 promoter region (Fig. 3C). Next, we knocked down CREB5 and detected RFC2 expression in SW480 cells. Both CREB5 and RFC2 levels were decreased when CREB5 was silenced (Fig. 3D). CREB5 knockdown reversed increased RFC2 expression induced by oe-RFC2 (Fig. 3E). CREB5 knockdown inhibited cell proliferation, migration, and invasion, which were blocked by RFC2 overexpression (Fig. 3F-H).

Fig. 3
figure 3

CREB5 regulates RFC2 transcriptional activity. A A sketch map of RFC2 promoter region. B The ov-CREB5 or ov-NC-transfected cells were transfected with promoter WT or mutant and luciferase activity was detected using dual-luciferase reporter assay. C ChIP assay was performed in cells. D Western blot of CREB5 and RFC2 in cells. E RFC2 protein in cells was measured using western blot. F Cell viability was examined using CCK-8 assay. G Wound healing assay was conducted in cells. H Transwell assay was performed in cells. *p < 0.05 vs. ov-NC + RFC2-luc, lgG, si-NC, or si-NC + vector group. #p < 0.05 vs. si-NC + RFC2 group

Full size image

RFC2 promotes aerobic glycolysis in CRC cells

By using GSEA analyzers based on RFC2 expression in CRC from the TCGA database, RFC2-enriched pathways are shown in Fig. 4A. GSEA indicated that RFC2 was associated heavily with glycolysis (Fig. 4B). Compared with si-NC treatment, si-RFC2 treatment in HCT116 and SW480 cells was associated with a remarkable decrease in glucose uptake and lactate production; however, compared with vector treatment, oe-RFC2 treatment in HCT116 and SW480 cells resulted in a notable induction in glucose uptake and lactate production (Fig. 4C and D). RFC2 knockdown remarkably decreased LDHA, GLUT1, and HK2 expression in HCT116 and SW480 cells; whereas their expression was significantly increased after upregulation of RFC2 (Fig. 4E).

Fig. 4
figure 4

RFC2 promotes aerobic glycolysis in CRC cells. A and B Results from GSEA forecast. C and D Glucose uptake and lactate production were detected in cells. E Marker proteins of glycolysis were detected using western blot. *p < 0.05 vs. si-NC or Vector group

Full size image

RFC2 activates the MET/PI3K/AKT/mTOR pathway in CRC cells

Based on the GESA forecast, RFC2 activated the PI3K/AKT/mTOR pathway in CRC (Fig. 5A). RFC2 expression was positively correlated with MET expression (Fig. 5B). RFC2 knockdown restrained MET protein expression in both HCT116 and SW480 cell lines, and its overexpression significantly enhanced MET protein expression (Fig. 5C). RFC2 knockdown decreased the levels of p-PI3K, p-AKT, p-mTOR, and p-70S6K in both HCT116 and SW480 cell lines, whereas RFC2 overexpression induced above levels (Fig. 5D).

Fig. 5
figure 5

RFC2 activates the MET/PI3K/AKT/mTOR pathway in CRC cells. A Results from GSEA forecast. B Correlation analysis between RFC2 and MET based on TCGA-COAD datasets using Pearson’s correlation analysis. C MET protein expression in cells was measured using western blot. D Representative protein expression in the PI3K/AKT/mTOR pathway was measured using western blot. *p < 0.05 vs. si-NC or Vector group

Full size image

Activator or inhibitor partially rescues the effect of RFC2 knockdown or overexpression in CRC cells

740Y-P attenuated the decreased cell viability, migration, and invasion caused by knockdown of RFC2. Furthermore, LY294002 led to a decrease in cell viability, migration, and invasion in RFC2-overexpression cells compared with untreated cells (Fig. 6A-C). 740Y-P restored RFC2 silencing-induced inhibition of glucose uptake, lactate production, and LDHA, GLUT1, and HK2 expression. LY294002 reversed RFC2-mediated promotion of glucose uptake, lactate production, and LDHA, GLUT1, and HK2 expression (Fig. 6D-F).

Fig. 6
figure 6

Activator or inhibitor partially rescues the effects of RFC2 knockdown or overexpression in CRC cells. A Cell viability was examined using CCK-8 assay. B and C Wound healing and transwell assays were conducted in SW480 cells. D and E Glucose uptake and lactate production were detected in SW480 cells. F Marker proteins of glycolysis were detected using western blot. *p < 0.05 vs. si-NC or Vector group. #p < 0.05 vs. si-RFC2-2 or oe-RFC2 group

Full size image

Discussion

RFC2 is famous for DNA replication and damage repair, and participates in disorder of biological process, such as Williams-Beuren syndrome, type 2 diabetes mellitus, and cancers [25,26,27]. Previous experimental studies have shown that RFC2 is highly expressed in various cancer, such as sarcoma, diffuse lower-grade gliomas, hepatocellular carcinoma, and CRC [18, 20, 28, 29]. We also found that RFC2 is overexpressed in CRC tissues compared to normal tissues. High expression of RFC2 predicted poor prognosis of patients with CRC. Similarly, high expression of RFC2 is related to worse overall survival of hepatocellular carcinoma [29]. Our results suggested that RFC2 is an oncogene and a promising prognostic biomarker of CRC. In CRC cells, RFC2 aggravated malignant proliferation, migration, and invasion.

TF is important regulators of intrinsic life processes within cells, possess DNA-binding domains and initiate transcription of genes [30]. Over the years, a large amount of data from different laboratories has shown that TFs are involved in progression of cancer [31,32,33]. For instance, FoxO1 promotes glioma cell proliferation by acting as a transcriptional activator of RFC2 [34]. CREB5 is a TF that mediates gene expression in cells [35]. CREB5 promotes metastasis of CRC by interacting with the MET promoter and activating the MET pathway [22]. CREB5 inhibits mitochondrial apoptosis by promoting the transcription of TOP1MT in head and neck squamous cell carcinoma [23]. Our study found that CREB5 enhanced RFC2 transcriptional activity by interacting with RFC2 promoter in CRC cells. CREB5 knockdown inhibited proliferation, migration, and invasion abilities, which were blocked by RFC2 overexpression.

Aerobic glycolysis is a notable feature of malignant cancers, that enhances unrestricted tumor growth and metastasis [36]. Normally, tumor cells preferentially rely on aerobic glycolysis for the source of energy and nutrition, even when oxygen is abundant [37]. Therefore, targeting glycolysis is a valuable and promising therapeutic strategy for the treatment of CRC. In our study, silencing of RFC2 dramatically decreased glucose uptake and lactate production, whereas, overexpression of RFC2 promoted glucose uptake and lactate production. LDHA, GLUT1, and HK2 expression are elevated in CRC [38,39,40]. In our study, RFC2 knockdown remarkably decreased LDHA, GLUT1, and HK2 expression in HCT116 and SW480 cells; whereas their expression was significantly increased after downregulation of RFC2. Conformably, Jing et al. have demonstrated that NCAPD3 induces the expression of glycolytic regulators (GLUT1, HK2, ENO1, PKM2 and LDHA), and finally promotes the progression of CRC [41]. We elucidated that RFC2 enhanced aerobic glycolysis in CRC cells.

MET regulates the proliferation, migration, and invasion of cancer cells by mediating the pathways such as PI3K/AKT pathway, MAPK pathway, and FAK pathway [42, 43]. MET is highly expressed in advanced stages of CRC and indicates worse prognosis and mortality [44]. Zhang et al. have revealed that HSF4 facilitates tumor progression of CRC by transactivating MET [45]. In current study, RFC2 expression was positively correlated with MET expression. RFC2 knockdown restrained MET protein expression in both HCT116 and SW480 cell lines, and its overexpression significantly enhanced MET protein expression.

In order to better understand the mechanisms of RFC2 in CRC, pathways were enriched using GSEA. RFC2 expression is connected with the PI3K/AKT/mTOR pathway. Down-regulated phosphorylation of PI3K, AKT, mTOR, and 70S6K in CRC cells leads to inhibition of proliferation and aerobic glycolysis [46, 47]. Li et al. have demonstrated that knockdown FOXO6 suppresses the proliferation, invasion, and glycolysis of CRC cells by inactivating PI3K/Akt/mTOR pathway [48]. In this study, knockdown RFC2 inactivated PI3K/AKT/mTOR pathway. Treatment with 740Y-P (PI3K activator) abrogated phenomena induced by silencing of RFC2, demonstrating that RFC2 could regulate malignant progression of tumor cells through PI3K/AKT/mTOR pathway.

Conclusion

RFC2 expression was upregulated in CRC. RFC2 promoted proliferation, migration, invasion by affecting aerobic glycolysis and the MET/PI3K/AKT/mTOR pathway in CRC cells. Our research demonstrated that RFC2 might be a candidate gene for the therapy of CRC.

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

References

  1. Baidoun F, Elshiwy K, Elkeraie Y, Merjaneh Z, Khoudari G, Sarmini MT, Gad M, Al-Husseini M, Saad A. Colorectal Cancer Epidemiology: Recent Trends and Impact on Outcomes. Curr Drug Targets. 2021;22(9):998–1009.

    CAS  PubMed  Google Scholar 

  2. Sung H, Ferlay J, Siegel RL. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021;71(3):209–49.

    PubMed  Google Scholar 

  3. Li N, Lu B, Luo C, Cai J, Lu M, Zhang Y, Chen H, Dai M. Incidence, mortality, survival, risk factor and screening of colorectal cancer: A comparison among China, Europe, and northern America. Cancer Lett. 2021;522:255–68.

    CAS  PubMed  Google Scholar 

  4. Chen H, Li N, Ren J, Feng X, Lyu Z, Wei L, Li X, Guo L, Zheng Z, Zou S, et al. Participation and yield of a population-based colorectal cancer screening programme in China. Gut. 2019;68(8):1450–7.

    PubMed  Google Scholar 

  5. Yao L, Zhang H, Wang W, An X, Cheng Z, Zhang X, Wang K, Zhang B. Clinical characteristics and prognosis of 196 Chinese patients with colon cancer. Front Surg. 2022;9:1008149.

    PubMed  Google Scholar 

  6. Abdel-Rahman O. Challenging a dogma: five-year survival does not equal cure in all colorectal cancer patients. Expert Rev Anticancer Ther. 2018;18(2):187–92.

    CAS  PubMed  Google Scholar 

  7. Alyabsi M, Sabatin F, Ramadan M, Jazieh AR. Colorectal cancer survival among Ministry of National Guard-Health Affairs (MNG-HA) population 2009–2017: retrospective study. BMC Cancer. 2021;21(1):954.

    CAS  PubMed  PubMed Central  Google Scholar 

  8. Takeshita E, Ishibashi K, Koda K, Oda N, Yoshimatsu K, Sato Y, Oya M, Yamaguchi S, Nakajima H, Momma T, et al. The updated five-year overall survival and long-term oxaliplatin-related neurotoxicity assessment of the FACOS study. Surg Today. 2021;51(8):1309–19.

    CAS  PubMed  Google Scholar 

  9. Shimada M, Okuzaki D, Tanaka S, Tougan T, Tamai KK, Shimoda C, Nojima H. Replication factor C3 of Schizosaccharomyces pombe, a small subunit of replication factor C complex, plays a role in both replication and damage checkpoints. Mol Biol Cell. 1999;10(12):3991–4003.

    CAS  PubMed  PubMed Central  Google Scholar 

  10. Li Y, Gan S, Ren L, Yuan L, Liu J, Wang W, Wang X, Zhang Y, Jiang J, Zhang F, et al. Multifaceted regulation and functions of replication factor C family in human cancers. Am J Cancer Res. 2018;8(8):1343–55.

    CAS  PubMed  PubMed Central  Google Scholar 

  11. Gong S, Qu X, Yang S, Zhou S, Li P, Zhang Q. RFC3 induces epithelial-mesenchymal transition in lung adenocarcinoma cells through the Wnt/β-catenin pathway and possesses prognostic value in lung adenocarcinoma. Int J Mol Med. 2019;44(6):2276–88.

    CAS  PubMed  PubMed Central  Google Scholar 

  12. Liu L, Tao T, Liu S, Yang X, Chen X, Liang J, et al. An RFC4/Notch1 signaling feedback loop promotes NSCLC metastasis and stemness. Nat Commun. 2021;12(1):2693.

    CAS  PubMed  PubMed Central  Google Scholar 

  13. Wang M, Xie T, Wu Y, Yin Q, Xie S, Yao Q, Xiong J, Zhang Q. Identification of RFC5 as a novel potential prognostic biomarker in lung cancer through bioinformatics analysis. Oncol Lett. 2018;16(4):4201–10.

    PubMed  PubMed Central  Google Scholar 

  14. Kim YR, Song SY, Kim SS, An CH, Lee SH, Yoo NJ. Mutational and expressional analysis of RFC3, a clamp loader in DNA replication, in gastric and colorectal cancers. Hum Pathol. 2010;41(10):1431–7.

    CAS  PubMed  Google Scholar 

  15. Xiang J, Fang L, Luo Y, Yang Z, Liao Y, Cui J, Huang M, Huang Y, Fan X, Wang H, et al. Levels of human replication factor C4, a clamp loader, correlate with tumor progression and predict the prognosis for colorectal cancer. J Transl Med. 2014;12(320):014–0320.

    Google Scholar 

  16. Wang XC, Yue X, Zhang RX, Liu TY, Pan ZZ, Yang MJ, Lu ZH, Wang ZY, Peng JH, Le LY, et al. Genome-wide RNAi Screening Identifies RFC4 as a Factor That Mediates Radioresistance in Colorectal Cancer by Facilitating Nonhomologous End Joining Repair. Clin Cancer Res. 2019;25(14):4567–79.

    CAS  PubMed  Google Scholar 

  17. Yao H, Zhou X, Zhou A, Chen J, Chen G, Shi X, Shi B, Tai Q, Mi X, Zhou G, et al. RFC5, regulated by circ_0038985/miR-3614-5p, functions as an oncogene in the progression of colorectal cancer. Mol Carcinog. 2023;62(6):771–85.

    CAS  PubMed  Google Scholar 

  18. Zhao X, Wang Y, Li J, Qu F, Fu X, Liu S, Wang X, Xie Y, Zhang X. RFC2: a prognosis biomarker correlated with the immune signature in diffuse lower-grade gliomas. Sci Rep. 2022;12(1):3122.

    CAS  PubMed  PubMed Central  Google Scholar 

  19. Ji Z, Li J, Wang J. Up-regulated RFC2 predicts unfavorable progression in hepatocellular carcinoma. Hereditas. 2021;158(1):17.

    CAS  PubMed  PubMed Central  Google Scholar 

  20. Hu T, Shen H, Li J, Yang P, Gu Q, Fu Z. RFC2, a direct target of miR-744, modulates the cell cycle and promotes the proliferation of CRC cells. J Cell Physiol. 2020;235(11):8319–33.

    CAS  PubMed  Google Scholar 

  21. Xiong S, Wang Q, Zheng L, Gao F, Li J. Identification of candidate molecular markers of nasopharyngeal carcinoma by tissue microarray and in situ hybridization. Med Oncol (Northwood, London, England). 2011;28(Suppl 1):S341–348.

    Google Scholar 

  22. Wang S, Qiu J, Liu L, Su C, Qi L, Huang C, Chen X, Zhang Y, Ye Y, Ding Y, et al. CREB5 promotes invasiveness and metastasis in colorectal cancer by directly activating MET. Journal of experimental & clinical cancer research : CR. 2020;39(1):168.

    CAS  PubMed Central  Google Scholar 

  23. Tong T, Qin X, Jiang Y, Guo H, Wang X, Li Y, Xie F, Lu H, Zhai P, Ma H, et al. A novel CREB5/TOP1MT axis confers cisplatin resistance through inhibiting mitochondrial apoptosis in head and neck squamous cell carcinoma. BMC Med. 2022;20(1):231.

    CAS  PubMed  PubMed Central  Google Scholar 

  24. Zhang M, Li Y, Wang H, Yu W, Lin S, Guo J. LncRNA SNHG5 affects cell proliferation, metastasis and migration of colorectal cancer through regulating miR-132-3p/CREB5. Cancer Biol Ther. 2019;20(4):524–36.

    CAS  PubMed  Google Scholar 

  25. Guenat D, Merla G, Deconinck E, Borg C, Rohrlich PS. DNA damage response defect in Williams-Beuren syndrome. Int J Mol Med. 2017;39(3):622–8.

    CAS  PubMed  PubMed Central  Google Scholar 

  26. Che X, Zhao R, Xu H, Liu X, Zhao S, Ma H. Differently Expressed Genes (DEGs) Relevant to Type 2 Diabetes Mellitus Identification and Pathway Analysis via Integrated Bioinformatics Analysis. Med Sci Monit. 2019;25:9237–44.

    CAS  PubMed  PubMed Central  Google Scholar 

  27. Albogami S, Alnefaie A. Role of Amygdalin in Blocking DNA Replication in Breast Cancer In Vitro. Curr Pharm Biotechnol. 2021;22(12):1612–27.

    CAS  PubMed  Google Scholar 

  28. Wu G, Zhou J, Zhu X, Tang X, Liu J, Zhou Q, Chen Z, Liu T, Wang W, Xiao X, et al. Integrative analysis of expression, prognostic significance and immune infiltration of RFC family genes in human sarcoma. Aging. 2022;14(8):3705–19.

    CAS  PubMed  PubMed Central  Google Scholar 

  29. Deng J, Zhong F, Gu W, Qiu F. Exploration of Prognostic Biomarkers among Replication Factor C Family in the Hepatocellular Carcinoma. Evol Bioinformatics Online. 2021;17:1176934321994109.

    Google Scholar 

  30. Weidemüller P, Kholmatov M. Transcription factors: bridge between cell signaling and gene regulation. Proteomics. 2021;21(23–24):e2000034.

  31. Safe S, Shrestha R, Mohankumar K, Howard M, Hedrick E, Abdelrahim M. Transcription factors specificity protein and nuclear receptor 4A1 in pancreatic cancer. World J Gastroenterol. 2021;27(38):6387–98.

    CAS  PubMed  PubMed Central  Google Scholar 

  32. Abadi AJ, Zarrabi A, Hashemi F, Zabolian A, Najafi M, Entezari M, Hushmandi K, Aref AR, Khan H, Makvandi P, et al. The role of SOX family transcription factors in gastric cancer. Int J Biol Macromol. 2021;180:608–24.

    CAS  PubMed  Google Scholar 

  33. Wilanowski T, Dworkin S. Transcription factors in cancer. Int J Mol Sci. 2022;23(8):4434.

    PubMed  PubMed Central  Google Scholar 

  34. Qiu X, Tan G, Wen H, Lian L, Xiao S. Forkhead box O1 targeting replication factor C subunit 2 expression promotes glioma temozolomide resistance and survival. Ann Transl Med. 2021;9(8):692.

    CAS  PubMed  PubMed Central  Google Scholar 

  35. Hwang JH, Arafeh R, Seo JH. CREB5 reprograms FOXA1 nuclear interactions to promote resistance to androgen receptor-targeting therapies. Elife. 2022;11:e73223.

  36. Pavlova NN, Thompson CB. The Emerging Hallmarks of Cancer Metabolism. Cell Metab. 2016;23(1):27–47.

    CAS  PubMed  PubMed Central  Google Scholar 

  37. Shamsi M, Saghafian M, Dejam M, Sanati-Nezhad A. Mathematical Modeling of the Function of Warburg Effect in Tumor Microenvironment. Sci Rep. 2018;8(1):8903.

    PubMed  PubMed Central  Google Scholar 

  38. Katagiri M, Karasawa H, Takagi K, Nakayama S, Yabuuchi S, Fujishima F, Naitoh T, Watanabe M, Suzuki T, Unno M, et al. Hexokinase 2 in colorectal cancer: a potent prognostic factor associated with glycolysis, proliferation and migration. Histol Histopathol. 2017;32(4):351–60.

    CAS  PubMed  Google Scholar 

  39. Mizuno Y, Hattori K, Taniguchi K, Tanaka K, Uchiyama K, Hirose Y. Intratumoral heterogeneity of glutaminase and lactate dehydrogenase A protein expression in colorectal cancer. Oncol Lett. 2020;19(4):2934–42.

    CAS  PubMed  PubMed Central  Google Scholar 

  40. Kuai XY, Lei ZY, Liu XS, Shao XY. The Interaction of GLUT1 and FOXM1 Leads to a Poor Prognosis in Colorectal Cancer. Anticancer Agents Med Chem. 2020;20(8):941–50.

    CAS  PubMed  Google Scholar 

  41. Jing Z, Liu Q, He X, Jia Z, Xu Z, Yang B, et al. NCAPD3 enhances Warburg effect through c-myc and E2F1 and promotes the occurrence and progression of colorectal cancer. J Exp Clin Cancer Res. 2022;41(1):198.

    CAS  PubMed  PubMed Central  Google Scholar 

  42. Yu J, Zhang L, Peng J, Ward R, Hao P, Wang J, Zhang N, Yang Y, Guo X, Xiang C, et al. Dictamnine, a novel c-Met inhibitor, suppresses the proliferation of lung cancer cells by downregulating the PI3K/AKT/mTOR and MAPK signaling pathways. Biochem Pharmacol. 2022;195(114864):30.

    Google Scholar 

  43. Garcia S, Dales JP, Charafe-Jauffret E, Carpentier-Meunier S, Andrac-Meyer L, Jacquemier J, Andonian C, Lavaut MN, Allasia C, Bonnier P, et al. Overexpression of c-Met and of the transducers PI3K, FAK and JAK in breast carcinomas correlates with shorter survival and neoangiogenesis. Int J Oncol. 2007;31(1):49–58.

    PubMed  Google Scholar 

  44. De Oliveira AT, Matos D, Logullo AF. SR DAS, Neto RA, Filho AL, Saad SS: MET Is highly expressed in advanced stages of colorectal cancer and indicates worse prognosis and mortality. Anticancer Res. 2009;29(11):4807–11.

    PubMed  Google Scholar 

  45. Zhang W, Zhang X, Cheng P, Yue K, Tang M, Li Y, Guo Q, Zhang Y. HSF4 promotes tumor progression of colorectal cancer by transactivating c-MET. Mol Cell Biochem. 2023;478(5):1141–50.

    CAS  PubMed  Google Scholar 

  46. Wang Y, Pan S, He X, Wang Y, Huang H, Chen J, et al. CPNE1 enhances colorectal cancer cell growth, glycolysis, and drug resistance through regulating the AKT-GLUT1/HK2 pathway. Onco Targets Ther. 2021;14:699–710.

    PubMed  PubMed Central  Google Scholar 

  47. Peng W, Huang W, Ge X, Xue L, Zhao W, Xue J. Type Iγ phosphatidylinositol phosphate kinase promotes tumor growth by facilitating Warburg effect in colorectal cancer. EBioMedicine. 2019;44:375–86.

    PubMed  PubMed Central  Google Scholar 

  48. Li Q, Tang H, Hu F, Qin C. Silencing of FOXO6 inhibits the proliferation, invasion, and glycolysis in colorectal cancer cells. J Cell Biochem. 2019;120(3):3853–60.

    CAS  PubMed  Google Scholar 

Download references

Acknowledgements

None.

Funding

None.

Author information

Authors and Affiliations

  1. Department of Endocrinology, The Second Hospital of Shandong University, Jinan, Shandong, 250033, P.R. China

    Fuchen Lou

  2. Department of Gastroenterology, The Second Hospital of Shandong University, Beiyuan Street 247,Tianqiao District, Jinan, Shandong, 250033, P.R. China

    Mingbao Zhang

Authors
  1. Fuchen Lou
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Mingbao Zhang
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

Conception and design: FC L; Data collection: FC L; Data analysis and interpretation: MB Z; Manuscript writing: All authors; Final approval of manuscript: All authors.

Corresponding author

Correspondence to Mingbao Zhang.

Ethics declarations

Ethics approval and consent to participate

The protocol of this research has been approved by the Ethics Committee of The Second Hospital of Shandong University. This study follows the principles of the Helsinki Declaration. All patients have signed written informed consent.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Lou, F., Zhang, M. RFC2 promotes aerobic glycolysis and progression of colorectal cancer. BMC Gastroenterol 23, 353 (2023). https://doi.org/10.1186/s12876-023-02984-0

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12876-023-02984-0

Keywords

BMC Gastroenterology

ISSN: 1471-230X

Contact us