Patient samples
Tumor samples and adjacent normal tissues were acquired during surgery from 22 untreated cancer patients. The study was approved by the Ethical Committee of the Medical Faculty of Medicine of Xi'an Jiaotong University. Informed consent was obtained from all subjects. Every patient sample was divided into three parts, namely tumor tissues, adjacent tissues (the distance from tumors was greater than 2 cm but less than 5 cm) and normal tissues. All samples were immediately frozen by liquid nitrogen and stored at -80°C before protein extraction.
Plasmids
To construct pCDNA3.1-His-LEF-1-ΔL and pCDNA3.1-His-LEF-1-FL, the short and long transcripts of LEF-1 were cloned by PCR from a human lymph node cDNA library. After sequencing, the correct clones were cut from pMD-18 T by HindIII and BamH I, and then inserted into pCDNA3.1/V5-His (Invitrogen), to generate target plasmids. LEF-1 variants and the tag did not fuse together and were expressed independently.
The primers used for cloning were as follows:
LEF-1-ΔL F: 5’- GGAAAGCATCCAGATGGAGGC-3’;
LEF-1-ΔL R: 5’- AATGAGCTTCGTTTTCCACCATG -3’;
LEF-1-FL F: 5’- CACAGCGGAGCGGAGATTACA -3’;
LEF-1-FL R: 5’- AATGAGCTTCGTTTTCCACCATG -3’;
Cell culture and transfection
The human colon cell lines SW480 and HT29 were cultured in RPMI1640 medium supplemented with 10% fetal bovine serum (FBS) and 2 mML glutamine (GIBCO/BRL). SW480 and HT29 cells were stably transfected using Lipofectamine™ 2000 (Invitrogen Life Technologies, Carlsbad, CA) according to the manufacturer’s protocol. Stable cell lines, including SW480-pCDNA3.1/V5-His, SW480-LEF-ΔL, HT29-pCDNA3.1/V5- His, HT29- LEF-1-ΔL and HT29-LEF-1-FL, were selected in the presence of 800 μg/ml G-418 (MERCK, Germany) for SW480 cells and 600 μg/ml for HT29 cells, and were maintained in RPMI1640 containing 10% FBS and 400 μg/ml of G-418.
MTT assay
Cells of the co-culture were collected on days 1-5 and were then seeded in 96-well plates (4 × 103 cells per well) with 100 μl of the medium. An equal volume of fresh medium containing 20% MTT (5 mg/ml) was added. Cells were incubated further at 37°C for 4 h, followed by the addition of 150 μl of dimethyl sulfoxide (Sigma) to each well and mixing by shaking at room temperature for 10 min. The absorbance was measured at 490 nm. Each experiment was repeated at least three times, and the data were analyzed with the Student’s t-test, with P < 0.05 being considered statistically significant.
Cell cycle analysis
Cells (1 × 106) were collected and washed with PBS, then fixed by incubating in 75% alcohol for 30 min at room temperature. After washing with cold PBS three times, cell were resuspended in 1 ml of PBS containing 40 μg propidium iodide (PI, Sigma) and 100 μg RNase A (Sigma) and incubated at 37°C for 30 min. Samples were analyzed for DNA contents, using a FACScalibur™ (BD Immunocytometry Systems, San Jose, CA). Each experiment was repeated at least three times.
Apoptosis
Apoptotic cells were detected using the AnnexinV-FITC Apoptosis Detection KIT I (Pharmingen, San Diego, CA), according to the manufacturer’s instructions.
Caspase activity assays
Caspase-3 fluorogenic substrate, Ac-DEVD-AFC, came from BD Biosciences (San Jose, CA, USA). Caspase activity in cell lysates was determined according to the manufacturer’s instructions, using an Aminco-Bow-man series-2 spectrofluorometer (440/500-nm excitation/emission), and expressed as a fold increase of caspase-3 over the control.
Plate colony-forming assay
The plate colony-forming assay process mainly refers to the work of Franken NA et al. [14]. Briefly, cells were plated in 35-mm plates at a density of 500 cells per well in the complete medium. Cells were cultured at 37°C in 5% CO2 for 14 days. After fixation using methanol for 10 min, the cells were stained with Giemsa stain for 15 min and colonies (with more than 50 cells) were photographed and counted by Image Pro Plus 6.0 software. Each experiment was repeated at least three times, and data were analyzed with one-way ANOVA analysis and LSD-t test.
Migration assay
Chemotaxis experiments were performed in polycarbonate transwell inserts (5 μm pore diameter, Corning Costar Corp.). Soluble SDF-1 (Peprotech) was added in the lower chamber at a concentration of 100 ng/ml. Cells (2 × 105) were seeded in the upper compartment and were cultured at 37°C for 18 h. Migrated cells in the lower chamber were photographed and counted under a microscope.
ECM adhesion assay
Wells of a 96-well plate with l0 g/L BSA and 5 mg/L matrigel at 4°C overnight. Some wells were left uncoated as negative controls. The coated plates were incubated at 37°C in a CO2 incubator for 45-60 min on the next day. Cells were counted and diluted to 4 × 105/ml and 50 μl of the cell suspension was added in each well. After incubation in a CO2 incubator at 37°C for 1 h, non-adherent cells were removed by washing with PBS. The number of adherent cells was counted with the MTT assay.
Western blotting
Whole-cell extracts were prepared by lysing cells with the RIPA buffer (50 mM Tris–HCl, pH7.9, 150 mM NaCl, 0.5 mM EDTA, and 0.5% NP-40, and 0.1 mM PMSF). Proteins were separated by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis, and were electroblotted onto polyvinylidene difluoride membranes. Membranes were probed using mouse-anti-human LEF-1 (1 C3.1D10, Chemicon International, Temecula, CA), monoclonal anti-β-actin (AC-74, Sigma) at appropriate dilutions, followed by incubation with horseradish peroxidase-conjugated secondary anti-rabbit or anti-mouse IgG antibody (Sigma). In some experiments, mouse-anti-His tag (R94025, Invitrogen) was used. Blots were developed using an enhanced chemiluminescence system (Roche, Basel, Switzerland).
Tumor formation
The tumor formation method was based on Hu et al. [15]. In detail, cells (5 × 106) were injected subcutaneously into nude mice. Eighteen days after the initial inoculation, tumor growth was monitored every 3 days by measuring the tumor length (L) and width (W) with a sliding caliper. Tumor size was calculated as L × W2 × 0.51. Thirty days after the initial inoculation, tumors were excised and weighed. All animal experiments were approved by and performed in accordance with guidelines from the Animal Experiment Administration Committee of the Medicine of Xi'an Jiaotong University, to comply with international humanitarian standards.
Histology and immunohistochemistry
Tissues were fixed in 4% paraformaldehyde, embedded in OCT, sectioned in 10 μm thicknesses, and stained with hematoxylin and eosin by standard methods. Immunohistochemistry was performed by standard procedures, with rat antimouse CD31 (1:200 dilution; Chemicon International) or rabbit antimouse HIF1α antibody (1:200 dilution; Chemicon International) as the primary antibody. Secondary antibodies included horseradish peroxidase–conjugated goat antirat IgG or antirabbit IgG (Boster BioTec, Wuhan, China). Samples were developed using a standard DAB reagent and were observed under a microscope. Microvessels were counted by different technicians to evaluate density, based on “hot fields,” which showed the most concentrated vessel regions. For quantification, pictures were captured and then pixels were counted by Image-Pro Plus 6.0 software (MediaCybernetics Inc., Bethesda, MD).
Statistics
Images were imported into Image Pro Plus 6.0 software, and pixels for each color were analyzed to quantitatively represent positively stained cells. Statistical analysis was performed with the SPSS 12.0 program. Results are expressed as mean ± SD. Comparisons between groups were undertaken using an unpaired Student's t-test. P < 0.05 was considered statistically significant.
