Open Access
Open Peer Review

This article has Open Peer Review reports available.

How does Open Peer Review work?

Role of tight junction proteins in gastroesophageal reflux disease

  • Klaus Mönkemüller1, 2,
  • Thomas Wex1Email author,
  • Doerthe Kuester3,
  • Lucia C Fry1, 2,
  • Arne Kandulski1,
  • Siegfried Kropf4,
  • Albert Roessner3 and
  • Peter Malfertheiner1
Contributed equally
BMC Gastroenterology201212:128

DOI: 10.1186/1471-230X-12-128

Received: 11 June 2012

Accepted: 19 September 2012

Published: 20 September 2012

Abstract

Background

Gastroesophageal reflux disease (GERD) is associated with impaired epithelial barrier function that is regulated by cell-cell contacts. The aim of the study was to investigate the expression pattern of selected components involved in the formation of tight junctions in relation to GERD.

Methods

Eighty-four patients with GERD-related symptoms with endoscopic signs (erosive: n = 47) or without them (non-erosive: n = 37) as well as 26 patients lacking GERD-specific symptoms as controls were included. Endoscopic and histological characterization of esophagitis was performed according to the Los Angeles and adapted Ismeil-Beigi criteria, respectively. Mucosal biopsies from distal esophagus were taken for analysis by histopathology, immunohistochemistry and quantitative reverse-transcription polymerase chain reaction (RT-PCR) of five genes encoding tight junction components [Occludin, Claudin-1, -2, Zona occludens (ZO-1, -2)].

Results

Histopathology confirmed GERD-specific alterations as dilated intercellular spaces in the esophageal mucosa of patients with GERD compared to controls (P < 0.05). Claudin-1 and −2 were 2- to 6-fold upregulation on transcript (P < 0.01) and in part on protein level (P < 0.015) in GERD, while subgroup analysis of revealed this upregulation for ERD only. In both erosive and non-erosive reflux disease, expression levels of Occludin and ZO-1,-2 were not significantly affected. Notably, the induced expression of both claudins did not correlate with histopathological parameters (basal cell hyperplasia, dilated intercellular spaces) in patients with GERD.

Conclusions

Taken together, the missing correlation between the expression of tight junction-related components and histomorphological GERD-specific alterations does not support a major role of the five proteins studied in the pathogenesis of GERD.

Keywords

Gastroesophageal reflux disease Tight junction Claudins Esophagitis Inflammation

Background

Gastroesophageal reflux disease (GERD) is one of the most prevalent gastrointestinal disorders in the world [1, 2]. Based on endoscopic findings GERD is differentiated in erosive (erosive reflux disease or ERD), non-erosive reflux disease (NERD) and Barrett’s esophagus (BE) [3, 4]. ERD is characterized by endoscopic visible breaks of esophageal mucosa integrity and classified according to various endoscopic classifications, most recently the Los Angeles classification [5, 6]. However, two thirds of patients with typical GERD symptoms do not exhibit visible mucosal changes in conventional esophagogastroduodenoscopy (EGD) and are thus diagnosed as having NERD [6, 7]. Although histology is not used in clinical practice for GERD diagnosis, frequent histological changes as basal cell hyperplasia, elongation of the papilla, inflammatory infiltrates and dilatation of the intercellular spaces are observed in the distal esophagus of patients with both ERD and NERD [811]. Dilations of the intercellular spaces (ICS) are characteristic changes of the esophageal mucosa of patients with ERD and NERD. ICS were described by various others using electron microscopy and are even characterized by light microscopy. This feature is being more widely proposed as an additional morphological feature of acid-induced damage to the squamous epithelium [10, 1214]. The widened ICS are supposed to permit the diffusion of molecules to the lamina propria where sensory nerve endings are located [15]. Therefore, ICS dilation even in the absence of endoscopically visible mucosal damage may explain the occurrence of symptoms in patients with NERD [16, 17]. Furthermore, recent studies have provided evidence that the impaired barrier function of esophageal mucosa is a “hallmark” of GERD [1820]. The integrity of epithelial surfaces is based on various cell-cell contacts that provide the structural basis for barrier function by regulating the diffusion of molecules and sorting of transmembrane proteins to apical and basolateral surfaces. Tight junctions, adherens junction and desmosomes are the three major structural units mediating barrier and sorting function [21, 22]. Their structural composition, general functions, and pathophysiological relevance have been reviewed extensively by others [21, 23, 24]. In line with the current concept in GERD, the role of molecules contributing to cell-cell contacts in esophageal mucosa in relation to GERD has been investigated in animal and human studies recently. Notably, the majority of studies were focused on the role of tight junction molecules (e.g. Claudin-2, -3, -4, -7 and −18) in Barrett’s metaplasia and carcinogenesis towards esophageal adenocarcinoma [2530]. In regard to the other 2 endoscopic entities (ERD, NERD), distinct alterations in the expression and or localization were described for Claudins 3 and 4 in GERD-related animal and in vitro models [3133]. Rat model revealed decreased expression of Claudin-3 and no change of Claudin-1 and 4 [31, 32], while an in vitro model of esophageal-like squamous cells demonstrated a prominent role of Claudin-4 [33].

Here, we studied the expression patterns of five tight-junction related molecules (Occludin, Claudin-1, -2 and Zonula occludens-1-, 2) in the esophageal mucosa of a prospective cohort of patients with GERD as well as reflux-negative individuals. Gene expression was assessed both on transcriptional and protein level, and changes were studied in context to histopathological alterations associated with GERD.

Methods

Study design and patients’ characteristics

Between 2005 and 2007, a cohort of patients with GERD and individuals lacking any symptom or endoscopic sign of GERD as GERD-negative controls were enrolled [34]. Patients with typical GERD-related symptoms based on Montreal classification [4] and patients without any reflux-related clinical symptoms undergoing EGD for screening or non-reflux dyspepsia (GERD-negative controls with a reflux disease questionnaire, RDQ score of 0) were invited to participate. All the patients underwent a detailed history and physical examination. The demographic data and endoscopic findings of the study population are presented in Table 1A and Table 1B. Written informed consent was obtained from all patients before endoscopy, after the endoscopist had explained the procedure to the patient in detail and answered all questions. The study was approved by the ethical committee of our institution and conducted according to the ethical guidelines of the declaration of Helsinki as revised in 1989.
Table 1

Patient groups analyzed by quantitative RT-PCR and immunohistochemistry

Quantitative RT-PCR

Controls

(n = 26)

NERD

(n = 37)

ERD

(n = 47)

Sex (male/female)

6/20

6/31

31/16#

Age (mean, sd, range)

52.3 ± 17.6

47.0 ± 14.1

47.5 ± 15.4

(20–79)

(18–72)

(20–79)

H. pylori-status (positive)

5/21

7/30

12/35

(23.1 %)

(22 %)

(29.2 %)

Immunohistochemistry

Controls (n = 12)

NERD (n = 13)

ERD (n = 16)

Sex (male/female)

2/10

4/9

10/6#

Age (mean, sd, range)

46.2 ± 19.1

48.9 ± 9.5

48.6 ± 14.1

(20–75)

(35–64)

(29–72)

H. pylori-status (positive)

4/8

2/11

7/9

(33.3 %)

(15.4 %)

(43.8 %)

Functional investigations such as 24 hour-pH-metry or MII-pH analysis were performed in individual cases only, and could not be included as separate parameter. The assignment of NERD was additionally based on the responsiveness to PPI therapy that was subsequently assessed.

Inclusion criteria

Female or male, age 18 to 80, able to provide written informed consent. Patients with typical reflux symptoms had to present symptoms at least three times a week. Typical reflux symptoms were defined as heartburn and regurgitation, as evaluated by the RDQ score. Patients with other types of reflux symptoms were not included in this study.

Exclusion criteria

Upper gastrointestinal pathology (e.g. peptic ulcers, cancers, polyps, and Barrett’s mucosa), systemic inflammatory, neoplastic or malabsorptive diseases (e.g. Crohn’s disease, ulcerative colitis, vasculitis, celiac disease), and acute medical conditions such as pneumonia, stroke, coronary ischemia and acute renal failure. Patients with known abnormal coagulation parameters and thrombocytopenia at the time of the procedure (i.e. INR > 1.2, platelet count < 80,000) were also excluded. None of the patients had taken antibiotics, or bismuth compounds or any H2-blockers or proton-pump inhibitors (PPI) in the last 2 weeks before entering the study. It is notable that the majority of patients enrolled had various anti-secretory medications in their past, and does not present GERD-naïve patients. Each patient was assigned a coded number. Histopathological assessment was done by pathologist (DK) blinded to clinical data.

Endoscopy and histopathology

The patients underwent the procedure after an overnight fast. The endoscopy was performed under conscious sedation with intravenous midazolam using a videogastroscope (Q160, Olympus, Hamburg). Endoscopic characterization of esophagitis was performed according to the “Los Angeles classification” [35] describing the following endoscopic landmarks: gastroesophageal junction (GEJ), Z-line, beginning of the gastric folds and diaphragmatic pinch. The GEJ was defined as the beginning of the gastric folds, whereas the Z-line was defined as the squamocolumnar junction. The cardia was defined as the mucosa lying immediately below the GEJ.

In the distal esophagus, 3 biopsies were taken 2 cm above the squamous-columnar junction at the 3 o'clock position. In case of erosions, specimens were taken 2 cm above the tip of the erosion. One biopsy was snap-frozen in liquid nitrogen for molecular analysis. The two other biopsies were immediately fixed in 4 % neutral-buffered formalin and submitted for histopathological examinations using hematoxilin and eosin, modified Giemsa and PAS stain. In analogy to the Sydney classification for gastritis, the density of intraepithelial neutrophils/eosinophils and lymphocytes were scored to evaluation active and chronic inflammation. Furthermore, degree of basal cell hyperplasia, presence of papillary elongation and dilated intercellular spaces were semiquantitatively scored as either 0 (absent), 1 (mild), 2 (moderate), or 3 (severe) as described previously [34]. Notably, several subgroups of the study cohort were published in regard to inflammatory mediators (e.g. cytokines, Protease-activated receptor 2) [34, 36], molecules related to barrier functions [37, 38], desmosomal proteins [39] and histopathological alterations [34].

Extraction of RNA and quantitative reverse transcription - polymerase chain reaction (RT-PCR) analysis of tight junction-related genes

Extraction of total RNA and cDNA synthesis were performed by the “two-step” protocol as described previously [40]. Transcript levels of Occludin, Claudin-1, -2, Zonula occludens-1, -2, and β-Actin were determined by quantitative real-time RT-PCR using an iCycler (BioRad, Munich, Germany) and the QuantiTect™ SYBR Green kit (Qiagen) using primers and standard conditions described in Table 2. Initial template mRNA amounts for all genes were calculated using iCycler software (Ct-values) and serial dilutions of plasmid DNA standard containing the corresponding PCR-fragments. Calculating template concentrations based on the Ct method and standard dilutions allowed an individual assessment of different efficiency for each PCR assay that were between 0.95 and 0.99. Gene-specific levels were normalized to the corresponding ß-actin level of the sample. Final results are expressed as arbitrary units (a.u.) and represent ratios between investigated gene and ß-Actin transcript amounts. All together, gene expression levels are identical to those calculated by the 2-∆∆ Ct-method [41], but they are additionally adjusted to the assay-specific efficiency. Due to the primer design (usage of intron-spanning regions), amplification of genomic DNA was excluded. All amplification products were checked for their correct size by agarose gel electrophoresis. Therefore, gene expression levels (a.u.) illustrate the mRNA pool of the individual gene studied.
Table 2

Characteristics of primers, RT-PCR protocol and antibodies

 

Primer sequence, length of fragment, annealing temperature

Antibody, Company, Antigen retrieval, final dilution

Occludin

fw: GGCCATTGCCATTGTACTGGG rv: GGAACCGGCGTGGATTTATAGG 315 bp; 58°C

polyclonal rabbit anti-occludin antibody No. 71–1500 (Invitrogen, Carlsbad, CA, USA), Protease-retrieval, Final dilution: 1:50

Claudin-1

fw: ATGGTGGTTGGCATCCTCCTG rv: GGCCTTGGTGTTGGGTAAGAGG 344 bp, 58°C

polyclonal rabbit anti-Claudin-1 antibody No. 51–9000, clone JAY.8 (Invitrogen, Carlsbad, CA, USA), EDTA-retrieval, Final dilution: 1:50

Claudin-2

fw: TCTCTTGGCCTCCAACTTGTGGG rv: GCACTGGATGTCACCATCATGGC 259 bp, 60°C

polyclonal rabbit anti-Claudin-2 antibody No. 51–6100 (Invitrogen, Carlsbad, CA, USA), EDTA-retrieval, Final dilution: 1:50

ZO-1

fw: TCTGATCATTCCAGGCACTCGC rv: CCACATCTGGTTGCCAACTTGG 225 bp, 58°C

polyclonal rabbit anti-ZO-1 antibody No. 61–7300, (Invitrogen, Carlsbad, CA, USA, Protease retrieval, Final dilution: 1:30

ZO-2

fw: AGAGGACACGCCGAGCAGATTG rv: TCCCGACATCATTGCCACCAG 272 bp, 60°C

polyclonal rabbit anti-ZO-2 antibody No. 71–1400, (Invitrogen, Carlsbad, CA, USA, EDTA retrieval, Final dilution: 1:150

β-Actin

fw: CATGCCATCCTGCGTCTGGACC rv: ACATGGTGGTGCCGCCAGACAG 400 bp, 60°C

not performed

Standard protocol

95°C: 15 min; (94°C: 30s, 58°-60°C: 30s, 72°C: 30s) 40 cycles; 72°C: 5 min

 

mab: monoclonal antibody, fw: forward, rv: reverse.

Immunohistochemical analysis of tight junctional components

Immunohistochemistry was performed using the avidin-biotin complex immunostaining method and the automated immunohistochemistry slide staining system by Ventana NexES (Ventana Medical System, Strasbourg, France) as described previously [36]. Details for antigen retrieval and primary antibodies are illustrated in Table 2. Dilutions of primary antibodies were determined using appropriate positive and negative controls. For negative controls, primary antibody was replaced by irrelevant rabbit IgG that did not reveal specific signals (data not shown). Immunoreactivity was assessed in 5 representative high power fields (Zeiss Axioskop 50) of each sample by one blinded pathologist (DK). For semiquantitative assessment an adaptation of a score system originally described by Remmele et al. was applied [42]. Briefly, staining intensity ([SI], 1 = weak, 2 = moderate, 3 = strong) and the percentage of positive cells ([PPC], 1 = <10%, 2 = 10-50%, 3 = 51–80%, 4= > 80%) were scored semiquantitatively, resulting in an immunoreactive score [IRS = SI x PC] between 0 and 12. Furthermore, a score for membranous staining (0 = none, 1 = weak, 2 = moderate, 3 = strong/complete) was added resulting in a possible maximum of 15 points for each sample.

Statistical analysis

Data are expressed as absolute number, relative proportion, median + range or mean ± standard deviation (SD) if not stated otherwise. Since the majority of data sets revealed skewed distribution, non-parametric Kruskal-Wallis test were applied for all comparisons made among the three groups (controls, NERD and ERD). If significant differences were identified (P < 0.05), post hoc analyses for pairwise comparisons between groups were performed using Mann–Whitney U test for gene expression analysis and immunohistochemistry. Age and histopathological parameters were analyzed by ANOVA and T test; frequencies by chi-square test. Non-parametric correlation analysis was performed by Spearman’s rank correlation test to investigate potential association between gene expression levels and histomorphological changes. Correlation analyses were performed in explorative manner only; adjustment for multiple comparisons was not performed. All tests were applied two-sided with a level of significance of P < 0.05.

Results

Patients and GERD-specific histomorphological changes

The three groups as well as the subgroups (randomly selected for immunohistochemistry) did not differ with respect to age and H. pylori status (Table 1). Histomorphological alterations are shown in Table 3. Activity and chronicity scores in esophageal mucosa were slightly higher in patients with NERD or ERD vs. controls without reaching significance. Basal cell hyperplasia, dilated intercellular spaces and elongation of papilla were significantly increased in both endoscopic entities (Table 3).
Table 3

Histopathological parameters

 

Controls

 NERD

 ERD

P-value One way ANOVA

Activity

0 ± 0

0.23 ± 0.54

0.22 ± 0.41

n.s.

Chronicity

0.72 ± 0.54

0.97 ± 0.51

1.05 ± 0.67

n.s.

Basal cell hyperplasia [BSH]

0.52 ± 0.59

1.11 ± 0.63

1.42 ± 0.84

<0.001

Papillary elongation [PE]

1.32 ± 0.80

1.71 ± 0.86

2.07 ± 0.85

<0.001

Dilated intercellular spaces [ICS]

0.72 ± 0.68

1.49 ± 1.01

2.10 ± 0.13

<0.001

Parameters were scored semiquantitatively as described in “Patients and Methods”. Data are presented as mean ± sd.

Upregulation of tight junction-related proteins in esophageal mucosa in context to the presence of gastroesophageal reflux disease

As exemplarily demonstrated in figure 1, Claudin-1 transcript and protein levels in esophageal mucosa were significantly increased in patients with ERD, while a weaker increase was noted in NERD compared to controls. Corresponding data for the other four genes (Claudin-2, ZO-1, ZO-2; Occludin) including those of Claudin-1 are summarized in tables 4A and 4B. Claudin-2 had a similar expression pattern as Claudin-1, and both ZO-1 and ZO-2 showed a tendency to higher transcript levels in ERD and NERD (P-values <0.07, Table 4A). In addition to the upregulation in context to controls, both transcript levels and immunohistochemical scores of Claudin-1 were significantly higher in patients with ERD compared to those with NERD (Figure 1).
https://static-content.springer.com/image/art%3A10.1186%2F1471-230X-12-128/MediaObjects/12876_2012_Article_801_Fig1_HTML.jpg
Figure 1

Expression of Claudin-1 in the esophageal mucosa of patients with NERD and ERD. The upper panel presents data of RT-PCR analysis; the lower panel illustrates immunohistochemical scores. Data are shown as boxplots illustrating 25, 75 percentile, median and 5–95 range. Note that due to skewed data distribution Claudin-1 (ERD) is presented as line only. Significant differences compared to controls are marked by a star (#); further details are presented in Tables 4A, and B.

Table 4

Expression of tight junction-related components in esophageal mucosa in patients with GERD

Panel A

Transcript level

Gene expression/ß-actin (a.u.) median (range)

Changevs.

controls (x-fold)

P-values (* Kruskal-Wallis; posthoc: Man WhitneyUtest)

Occludin

  

0.098*

controls

0.041 (0.0086 - 0.38)

  

NERD

0.060 (0.0052 - 0.57)

1.46

n.a.

ERD

0.035 (0.0026 - 1.09)

0.85

n.a.

Claudin-1

  

0.0097*

controls

0.078 (0.0072 - 2.54)

  

NERD

0.15 (0.012 - 1.6)

1.92

0.016

ERD

0.20 (0–4.1)

2.56

0.0032

Claudin-2

  

0.0027*

controls

0.000038 (0–0.003)

  

NERD

0.0002 (0–0.019)

5.26

0.0041

ERD

0.000083 (0–0.021)

2.18

0.11

ZO-1

  

0.069*

controls

0.0060 (0.0012 - 0.073)

  

NERD

0.0081 (0–0.067)

1.35

n.a.

ERD

0.0077 (0.0015 - 0.21)

1.28

n.a.

ZO-2

  

0.061*

controls

0.011 (0.0022 - 0.038)

  

NERD

0.019 (0.002 - 0.27)

1.72

n.a.

ERD

0.021 (0.0019 - 0.59)

1.9

n.a.

Panel B

Protein level

IHC score

median (range)

Change (x-fold)

vs. controls

P -values (* Kruskal-Wallis;

posthoc: Man Whitney U test)

Occludin

  

0.02*

controls

3 (1 – 9)

 

-

NERD

6 (1 – 15)

2.0

0.026

ERD

8 (1 – 12)

2.7

0.012

Claudin-1

  

0.014*

controls

1 (1 – 4)

 

-

NERD

2 (1 – 9)

2.0

0.14

ERD

6 (1 – 8)

6.0

0.0004

Claudin-2

  

0.0057*

controls

4 (1 – 9)

 

-

NERD

6 (1 – 12)

1.5

0.28

ERD

9 (4 –15)

2.25

0.0025

ZO-1

  

0.62*

controls

2 (0 – 6)

 

-

NERD

4 (1 –12)

2.0

n.a.

ERD

3 (0 – 3)

1.5

n.a.

ZO-2

  

0.58*

controls

4 (0 – 10)

 

-

NERD

4 (0 – 8)

1.0

n.a.

ERD

1 (0 – 8)

0.25

n.a.

Transcript levels are shown in relation to controls (Panel A). Immunohistochemical scores are illustrated similarly (Panel B). Statistical analyses for both datasets were done first by non-parametric Kruskal-Wallis (P-value italic style); if significant post-hoc analysis was done by Mann Whitney U test. Significant changes are demonstrated by bold letters. n.a.: not applicable.

In general, higher transcript levels were accompanied by higher immunohistochemical scores for most proteins. In addition to these quantitative changes in gene expression, different patterns of protein distribution within the cell compartment and within different mucosal layers were noted (Figure 2). In controls, the expression of tight junction-related proteins was mainly observed in the basal epithelial layers and in a cytoplasmatic pattern. In GERD, expansion of protein expression to the suprabasal und spinous epithelial layers was observed. Furthermore, expression of Claudin-1, Claudin-2 and ZO-1 was partly membrane-associated with a stronger intensity in GERD compared to controls.
https://static-content.springer.com/image/art%3A10.1186%2F1471-230X-12-128/MediaObjects/12876_2012_Article_801_Fig2_HTML.jpg
Figure 2

Immunohistochemical stainings of tight junction-related proteins in esophageal mucosa. Occludin, Claudin-1, -2 and ZO-1,-2 are displayed by brown or red staining, respectively. Panels illustrate representative staining for controls and samples obtained from patients with NERD. Immunohistochemical staining was observed in the esophageal squamous epithelium mainly at the basal and suprabasal zone. Claudin-1/2 and ZO-1 showed partly a membranous staining. (Zeiss Axioskop 50; camera: Nikon coolpix 990).

Increased gene expression of tight junction-related molecules (transcript level) does not correlate with histomorphological changes in esophageal mucosa

In order to study potential correlations between gene expression levels (transcript level) and the degree of histopathological alterations, all three groups were analyzed together in the first step. As exemplarily illustrated in figure 3, gene expression levels of Claudin-1 and Claudin-2 marginally correlated with the degree of basal cell hyperplasia, but not with dilated intercellular spaces and length of papilla (data not shown). Since most analyses were negative, these data are summarized in Table 5A for all five genes. Since basal cell hyperplasia revealed some even weak correlations in the complete study cohort, these correlation analyses were performed again for all three groups individually and for patients with GERD (NERD + ERD) combined. Only 3 out of 20 subanalyses revealed marginally significant correlations (without adjustment for multiple comparisons), two of those were identified in controls (data summarized in Table 5B).
https://static-content.springer.com/image/art%3A10.1186%2F1471-230X-12-128/MediaObjects/12876_2012_Article_801_Fig3_HTML.jpg
Figure 3

Correlation of Claudin-1 and Claudin-2 with histomorphological changes in esophageal mucosa. Panels illustrate correlations between transcript levels and histomorphological alterations as indicated. Data are shown as open dot plots; medians are presented filled dot. Non-parametric correlation analysis was performed by Spearman’s rank correlation test; P values are presented in figure. Detailed data of other correlations are presented in Tables 5A, and 5B.

Table 5

Correlation between GERD-specific histopathological alterations and gene expression level of tight junction-related genes (transcript level)

Panel A: All samples

Occludin

Claudin-1

Claudin-2

ZO-1

ZO-2

Activity

n.s.

r = 0.23

n.s.

n.s.

n.s.

 

P = 0.07

   

Chronicity

n.s.

n.s.

n.s.

n.s.

n.s.

Basal cell hyperplasia

n.s.

r = 0.19

r = 0.21

r = 0.22

n.s.

 

P = 0.05

P= 0.04

P= 0.03

 

Elongation of papilla

n.s.

n.s.

n.s.

n.s.

n.s.

Dilated intercellular space

n.s.

n.s.

n.s.

n.s.

n.s.

Panel B: Basal cell hyperplasia

Occludin

Claudin-1

Claudin-2

ZO-1

ZO-2

Controls

r = 0.47

n.s.

n.s.

r = 0.36

r = 0.42

P= 0.02

  

P = 0.08

P= 0.04

NERD

r = 0.36

n.s.

n.s.

n.s.

n.s.

P= 0.03

    

ERD

n.s.

n.s.

n.s.

n.s.

n.s.

GERD (ERD + NERD)

n.s.

n.s.

n.s.

n.s.

n.s.

Panel A: The histopathological scores (Table 3) were correlated with gene expression levels (transcript levels, Table 4) for each gene individually in the combined study cohort (n = 110). Data (r-, and P-values) represent potential correlations between these parameters (n.s. = not significant). Panel B: Since basal cell hyperplasia demonstrated significant correlations in global analysis (Panel A), this parameter was further analyzed by correlating expression values for all five genes with basal cell hyperplasia within each group and for patients with GERD individually as identified in table.

In addition to the correlation based on transcript levels (Figure 3, Table 5), correlation analysis between protein expression levels (immunohistochemical scores, Table 4B) and histopathological alterations (Table 3) was performed. Here, only one significant correlation (between Claudin-1 and activity of inflammation, r = 0.51, P < 0.01) was identified (data not shown).

Discussion

In this study, we demonstrated (I) distinct expression patterns of five genes encoding for proteins involved in the formation of tight junctions in esophageal mucosa. In particular Claudin-1 in ERD and to lesser extent Claudin-2 was expressed at higher levels in patients with GERD. In contrast, ZO-1, ZO-2, and Occludin were not affected by the presence of GERD. (II) In general, altered gene expression of Claudin-1/-2 did not correlate with the degree of histomorphological changes in the esophageal mucosa of patients with GERD.

Tight junctions are composed of transmembrane proteins such as Occludin, 24 Claudins, several junctional adhesion molecules (JAMs) with different isoforms, E-Cadherin as well as cytosolic binding partners [43, 44]. The selection of the five genes studied was based on functional aspects. Occludin is critical for the formation of tight junctions in most tissues [45]. Claudin-1 is one of the numerous Claudins that seals intercellular space leading to higher barrier function [46], while Claudin-2 is the only pore-forming member of this family resulting in increased permeability [47]. Zonula occludens (ZO)-1 and-2 are cytosolic partners of tight junctions in most epithelial surfaces [48, 49]. The selected genes present important components of the tight junctional complex, and were considered to allow assessment about alterations of tight junctions in relation to GERD. A comprehensive analysis concerning the general expression pattern of other junctional proteins was not performed.

Recently, several studies demonstrated characteristic histopathological alterations in esophageal mucosa of patients with GERD and a proinflammatory response including the activation of related pathways such as NFκB, PAR-2, ROS and iNOS [50, 51]. Several in vitro and animal studies have provided evidence that incubation of esophageal mucosa or squamous cell lines either with acidified media with/without bile acids or proinflammatory cytokines can provoke changes in transepithelial electric resistance and increased transepithelial permeability [5255]. Notably, several studies demonstrated a cytokine-mediated change of tight junction-related molecules in various cell models. For instance, IL-6 markedly induces Claudin-2 expression via MEK and PI3K signaling leading to increased tight junction permeability [56]. In a rabbit model of GERD, elevated IL-6 expression correlated with induction of several tight junction-related proteins (Claudin-1, Occludin, JAM-1, ZO-1) [57] and altered the motogenic activity of smooth muscle cells [58].

All together, there is sufficient data showing that the exposure of mixed gastric or gastroduodenal refluxate causes altered esophageal epithelial barrier function, inflammation and cellular damage, although the timely order of these processes is a matter of debate [20]. As today, it is well accepted that impaired epithelial barrier function of the distal esophagus presents a major pathophysiological process in GERD.

This study shows an upregulation of tight junction-related proteins in relation to ERD and NERD in mucosal samples. In particular, Claudin-1 and Claudin-2, though mediating opposite functionally effects, were induced, while cytoplasmic adapters and Occludin were rather unchanged in relation to controls. The higher expression of Claudin-1 (both on transcript and protein level) was the only significant difference identified between patients with ERD and NERD. The fact that all other identified changes were similar between NERD and ERD supports the concept of similar pathophysiological mechanisms between both diseases. Unexpectedly, these changes did not correlate with histomorphological alterations, in particular with dilated ICS in esophageal mucosa. This finding is in contrast to the recently identified correlation between histopathological alterations, in particular basal cell hyperplasia, and elevated gene expression of desmosomal proteins [39]. In this study, few borderline correlations were found for basal cell hyperplasia and some genes only, but notably these findings were mostly restricted to reflux-negative controls, whereas patients with GERD did not reveal significant correlations between histopathological alterations and transcript levels of the five genes. Since correlation analyses were performed in an explorative way (without adjustment for multiple comparison), the few significant correlations (with borderline significance) do not support a general role of these findings for the pathophysiology of GERD. Taken into consideration this limitation and the fact that that the overall majority of our comparisons (17 out of 20) revealed no correlations, we conclude that our data do not give evidence for an association between the gene expression of the five genes studied and the histopathological changes in our study groups. It is well known that extent of basal cell hyperplasia reflects proliferative status of esophageal mucosa [9]. Since the identified correlations between gene expression levels and basal cell hyperplasia were mostly restricted to controls, it is unlikely that elevated Claudin-1 levels in ERD reflect tissue repair in context to mucosal damage caused by refluxate in these patients. Since we and others demonstrated more severe histomorphological alterations in ERD than NERD, the overall consistent changes of the 5 genes and their corresponding proteins in both diseases seem to be of limited relevance to the mucosal integrity and function. Furthermore, it is notable that some of the stainings revealed not the typical membrane-restricted expression pattern as demonstrated for these tight junction-related molecules im most gastrointestinal tissues [59, 60]. However, cytoplasmic or diffuse membranous expression patterns have been identified for Claudin-2 [60] and ZO-1 [61] in human gastrointestinal tissue and for Claudin-1 in esophageal mucosa of rat [62]. Occludin staining pattern or expression in esophageal mucosa differs frequently also from those identified in gastric or intestinal mucosa [60, 63]. Overall, the subcellular distribution of the 5 tight junction-related proteins seems to differ partially from those identified in columnar-lined epithelium. However, the study was not aimed to analyze the subcellular distribution pattern of the molecules in esophageal mucosa on the subcellular level. The presence of appropriate negative and positive control stainings in other tissues, and the good concordance between expression data on transcript and protein level in general provide further indirect evidence for the specificity of immunohistochemical stainings.

Based on the descriptive study design, it remains open whether the altered gene expression levels of Claudin-1 and −2 contribute to GERD pathophysiology or merely are markers for the existing disease. Furthermore it is notable that the majority of patients received GERD medications (PPI, H2RA) in the past before entering study. Even a stop of at least 2 weeks was mandatory to enter the study, we can not exclude that the effects of long-term therapy in the past or the changes induced by the 2-week stop of medication (e.g. acid rebound) [64] could have affect the expression of the five genes studied. Another limitation is the assessment of protein expression by an immunohistochemical score that can be done semiquantitatively at best. Besides this methodological aspect, posttranscriptional regulatory mechanisms can lead to different findings between gene expression analysis performed on transcript and protein levels. But as mentioned above, overall we observed a good concordance between both levels even not all significant findings were confirmed by both methodologies. Since we studied five selected components of tight junction complexes in GERD only, general conclusions can not be made. Assessment of other tight junction related molecules (e.g. Claudins, JAMs, Tricellulin) [44, 46, 65] in regard to GERD needs to be performed.

Conclusions

In summary, this study demonstrates a partial upregulation of tight junction-related components, in particular Claudin-1, in relation to GERD. Since identified molecular changes do not correlate with histomorphological alterations in general, a major role of Claudin-1 as of the other four tight junction-related proteins in the pathogenesis of GERD can not be concluded from our study.

Notes

Abbreviations

BE: 

Barrett’s esophagus

ERD: 

Erosive reflux disease

NERD: 

Nonerosive reflux disease

GEJ: 

Gastroesophageal junction

GERD: 

Gastroesophageal reflux disease

H2RA: 

Histamine-receptor antagonist

H. pylori: 

Helicobacter pylori

ICS: 

Intercellular spaces

INR: 

International normalized ratio

iNOS: 

Inducible nitro oxygen synthetase

JAM: 

Junctional adhesion molecule

NFκB: 

Nuclear factor kappa B

PAR-2: 

Protease activated receptor-2

PPI: 

Proton pump inhibitor

RDQ: 

Reflux disease questionnaire

ROS: 

Reactive oxygen species

RT-PCR: 

Reverse transcription polymerase chain reaction

ZO: 

Zona occludens.

Declarations

Acknowledgements

We thank the endoscopy team for their technical assistance and Ursula Stolz, Simone Philipsen and Nadine Schüler (all from the Division of Gastroenterology) and Nadine Wiest, Claudia Miethke and Carola Kügler (Institute of Pathology) for their excellent work in this study.

Authors’ Affiliations

(1)
Department of Gastroenterology, Hepatology and Infectious Diseases, Otto-von-Guericke University
(2)
Department of Gastroenterology, Hepatology, and Infectious Diseases Marienhospital
(3)
Institute of Pathology, Otto-von-Guericke University
(4)
Institute of Biometrics and Medical Informatics, Otto-von-Guericke University

References

  1. Locke GR, Talley NJ, Fett SL, Zinsmeister AR, Melton LJ: Prevalence and clinical spectrum of gastroesophageal reflux: a population-based study in Olmsted County, Minnesota. Gastroenterology. 1997, 112: 1448-1456. 10.1016/S0016-5085(97)70025-8.View ArticlePubMedGoogle Scholar
  2. Kang JY: Systematic review: geographical and ethnic differences in gastro-oesophageal reflux disease. Aliment Pharmacol Ther. 2004, 20: 705-717. 10.1111/j.1365-2036.2004.02165.x.View ArticlePubMedGoogle Scholar
  3. Malfertheiner P, Hallerbäck B: Clinical manifestations and complications of gastroesophageal reflux disease (GERD). Int J Clin Pract. 2005, 59: 346-355. 10.1111/j.1742-1241.2005.00370.x.View ArticlePubMedGoogle Scholar
  4. Vakil N, van Zanten SV, Kahrilas P, Dent J, Jones R, Global Consensus Group: The Montreal definition and classification of gastroesophageal reflux disease: a global evidence-based consensus. Am J Gastroenterol. 2006, 101: 1900-1920. 10.1111/j.1572-0241.2006.00630.x.View ArticlePubMedGoogle Scholar
  5. Genta RM, Spechler SJ, Kielhorn AF: The Los Angeles and Savary-Miller systems for grading esophagitis: utilization and correlation with histology. Dis Esophagus. 2011, 24: 10-17. 10.1111/j.1442-2050.2010.01092.x.View ArticlePubMedGoogle Scholar
  6. Winter JW, Heading RC: The nonerosive reflux disease-gastroesophageal reflux disease controversy. Curr Opin Gastroenterol. 2008, 24: 509-515. 10.1097/MOG.0b013e3283025c57.View ArticlePubMedGoogle Scholar
  7. Fry LC, Mönkemüller K, Malfertheiner P: Functional heartburn, nonerosive reflux disease, and reflux esophagitis are all distinct conditions–a debate: con. Curr Treat Options Gastroenterol. 2007, 10: 305-311. 10.1007/s11938-007-0073-4.View ArticlePubMedGoogle Scholar
  8. Ismail-Beigi F, Horton PF, Pope CE: Histological consequences of gastroesophageal reflux in man. Gastroenterology. 1970, 58: 163-174.PubMedGoogle Scholar
  9. Vieth M, Peitz U, Labenz J, Kulig M, Nauclér E, Jaspersen D, Meyer-Sabellek W, Willich S, Lind T, Malfertheiner P, Stolte M: What parameters are relevant for the histological diagnosis of gastroesophageal reflux disease without Barrett's mucosa?. Dig Dis. 2004, 22: 196-201. 10.1159/000080319.View ArticlePubMedGoogle Scholar
  10. Neumann H, Mönkemüller K, Fry LC, Dombrowski F, Kuester D, Beyer M, Malfertheiner P: Intercellular space volume is mainly increased in the basal layer of esophageal squamous epithelium in patients with GERD. Dig Dis Sci. 2011, 56: 1404-1411. 10.1007/s10620-010-1458-0.View ArticlePubMedGoogle Scholar
  11. Glickman JN, Spechler SJ, Souza RF, Lunsford T, Lee E, Odze RD: Multilayered epithelium in mucosal biopsy specimens from the gastroesophageal junction region is a histologic marker of gastroesophageal reflux disease. Am J Surg Pathol. 2009, 33: 818-825. 10.1097/PAS.0b013e3181984697.View ArticlePubMedGoogle Scholar
  12. Orlando LA, Orlando RC: Dilated intercellular spaces as a marker of GERD. Curr Gastroenterol Rep. 2009, 11: 190-194. 10.1007/s11894-009-0030-6.View ArticlePubMedGoogle Scholar
  13. Tobey NA, Carson JL, Alkiek RA, Orlando RC: Dilated intercellular spaces: a morphological feature of acid reflux–damaged human esophageal epithelium. Gastroenterology. 1996, 111: 1200-1205. 10.1053/gast.1996.v111.pm8898633.View ArticlePubMedGoogle Scholar
  14. Calabrese C, Fabbri A, Bortolotti M, Cenacchi G, Areni A, Scialpi C, Miglioli M, Di Febo G: Dilated intercellular spaces as a marker of oesophageal damage: comparative results in gastro-oesophageal reflux disease with or without bile reflux. Aliment Pharmacol Ther. 2003, 18: 525-532. 10.1046/j.1365-2036.2003.01713.x.View ArticlePubMedGoogle Scholar
  15. Orlando RC: Pathophysiology of gastroesophageal reflux disease. J Clin Gastroenterol. 2008, 42: 584-588. 10.1097/MCG.0b013e31815d0628.View ArticlePubMedGoogle Scholar
  16. Bredenoord AJ: Mechanisms of reflux perception in gastroesophageal reflux disease: a review. Am J Gastroenterol. 2012, 107: 8-15. 10.1038/ajg.2011.286.View ArticlePubMedGoogle Scholar
  17. Long JD, Orlando RC: Nonerosive reflux disease: a pathophysiologic perspective. Curr Gastroenterol Rep. 2008, 10: 200-207. 10.1007/s11894-008-0044-5.View ArticlePubMedGoogle Scholar
  18. Farré R, De Vos R, Geboes K, Verbecke K, Vanden Berghe P, Depoortere I, Blondeau K, Tack J, Sifrim D: Critical role of stress in increased oesophageal mucosa permeability and dilated intercellular spaces. Gut. 2007, 56: 1191-1197. 10.1136/gut.2006.113688.View ArticlePubMedPubMed CentralGoogle Scholar
  19. Jovov B, Que J, Tobey NA, Djukic Z, Hogan BL, Orlando RC: Role of E-cadherin in the pathogenesis of gastroesophageal reflux disease. Am J Gastroenterol. 2011, 106: 1039-1047. 10.1038/ajg.2011.102.View ArticlePubMedPubMed CentralGoogle Scholar
  20. Souza RF, Huo X, Mittal V, Schuler CM, Carmack SW, Zhang HY, Zhang X, Yu C, Hormi-Carver K, Genta RM, Spechler SJ: Gastroesophageal reflux might cause esophagitis through a cytokine-mediated mechanism rather than caustic acid injury. Gastroenterology. 2009, 137: 1776-1784. 10.1053/j.gastro.2009.07.055.View ArticlePubMedGoogle Scholar
  21. Niessen CM: Tight junctions/adherens junctions: basic structure and function. J Invest Dermatol. 2007, 127: 2525-2532. 10.1038/sj.jid.5700865.View ArticlePubMedGoogle Scholar
  22. Garrod D, Chidgey M: Desmosome structure, composition and function. Biochim Biophys Acta. 2008, 1778: 572-587. 10.1016/j.bbamem.2007.07.014.View ArticlePubMedGoogle Scholar
  23. Thomason HA, Scothern A, McHarg S, Garrod DR: Desmosomes: adhesive strength and signalling in health and disease. Biochem J. 2010, 429: 419-433. 10.1042/BJ20100567.View ArticlePubMedGoogle Scholar
  24. Yu QH, Yang Q: Diversity of tight junctions (TJs) between gastrointestinal epithelial cells and their function in maintaining the mucosal barrier. Cell Biol Int. 2009, 33: 78-82. 10.1016/j.cellbi.2008.09.007.View ArticlePubMedGoogle Scholar
  25. Souza RF, Freschi G, Taddei A, Ringressi MN, Bechi P, Castiglione F, Rossi Degl'Innocenti D, Triadafilopoulos G, Wang JS, Chang AC, Barr H, Bajpai M, Das KM, Schneider PM, Krishnadath KK, Malhotra U, Lynch JP: Barrett's esophagus: genetic and cell changes. Ann N Y Acad Sci. 2011, 1232: 18-35. 10.1111/j.1749-6632.2011.06043.x.View ArticlePubMedGoogle Scholar
  26. Jovov B, Van Itallie CM, Shaheen NJ, Carson JL, Gambling TM, Anderson JM, Orlando RC: Claudin-18: a dominant tight junction protein in Barrett's esophagus and likely contributor to its acid resistance. Am J Physiol Gastrointest Liver Physiol. 2007, 293: G1106-G1113. 10.1152/ajpgi.00158.2007.View ArticlePubMedGoogle Scholar
  27. Mullin JM, Valenzano MC, Trembeth S, Allegretti PD, Verrecchio JJ, Schmidt JD, Jain V, Meddings JB, Mercogliano G, Thornton JJ: Transepithelial leak in Barrett's esophagus. Dig Dis Sci. 2006, 51: 2326-2336. 10.1007/s10620-006-9478-5.View ArticlePubMedGoogle Scholar
  28. Montgomery E, Mamelak AJ, Gibson M, Maitra A, Sheikh S, Amr SS, Yang S, Brock M, Forastiere A, Zhang S, Murphy KM, Berg KD: Overexpression of claudin proteins in esophageal adenocarcinoma and its precursor lesions. Appl Immunohistochem Mol Morphol. 2006, 14: 24-30. 10.1097/01.pai.0000151933.04800.1c.View ArticlePubMedGoogle Scholar
  29. Fang D, Das KM, Cao W, Malhotra U, Triadafilopoulos G, Najarian RM, Hardie LJ, Lightdale CJ, Beales IL, Felix VN, Schneider PM, Bellizzi AM: Barrett's esophagus: progression to adenocarcinoma and markers. Ann N Y Acad Sci. 2011, 1232: 210-229. 10.1111/j.1749-6632.2011.06053.x.View ArticlePubMedGoogle Scholar
  30. Weimann A, Rieger A, Zimmermann M, Gross M, Hoffmann P, Slevogt H, Morawietz L: Comparison of six immunohistochemical markers for the histologic diagnosis of neoplasia in Barrett's esophagus. Virchows Arch. 2010, 457: 537-545. 10.1007/s00428-010-0972-y.View ArticlePubMedGoogle Scholar
  31. Oguro M, Koike M, Ueno T, Asaoka D, Mori H, Nagahara A, Uchiyama Y, Watanabe S: Dissociation and dispersion of claudin-3 from the tight junction could be one of the most sensitive indicators of reflux esophagitis in a rat model of the disease. J Gastroenterol. 2011, 46: 629-638. 10.1007/s00535-011-0390-1.View ArticlePubMedGoogle Scholar
  32. Miwa H, Koseki J, Oshima T, Kondo T, Tomita T, Watari J, Matsumoto T, Hattori T, Kubota K, Iizuka S: Rikkunshito, a traditional Japanese medicine, may relieve abdominal symptoms in rats with experimental esophagitis by improving the barrier function of epithelial cells in esophageal mucosa. J Gastroenterol. 2010, 45: 478-487. 10.1007/s00535-009-0180-1.View ArticlePubMedGoogle Scholar
  33. Oshima T, Koseki J, Chen X, Matsumoto T, Miwa H: Acid modulates the squamous epithelial barrier function by modulating the localization of claudins in the superficial layers. Lab Invest. 2012, 92: 22-31. 10.1038/labinvest.2011.139.View ArticlePubMedGoogle Scholar
  34. Mönkemüller K, Wex T, Kuester D, Fry LC, Peitz U, Beyer M, Roessner A, Malfertheiner P: Interleukin-1beta and interleukin-8 expression correlate with the histomorphological changes in esophageal mucosa of patients with erosive and non-erosive reflux disease. Digestion. 2009, 79: 186-195. 10.1159/000211714.View ArticlePubMedGoogle Scholar
  35. Lundell LR, Dent J, Bennett JR, Blum AL, Armstrong D, Galmiche JP, Johnson F, Hongo M, Richter JE, Spechler SJ, Tytgat GN, Wallin L: Endoscopic assessment of oesophagitis: clinical and functional correlates and further validation of the Los Angeles classification. Gut. 1999, 45: 172-180. 10.1136/gut.45.2.172.View ArticlePubMedPubMed CentralGoogle Scholar
  36. Kandulski A, Wex T, Mönkemüller K, Kuester D, Fry LC, Roessner A, Malfertheiner P: Proteinase-activated receptor-2 in the pathogenesis of gastroesophageal reflux disease. Am J Gastroenterol. 2010, 105: 1934-1943. 10.1038/ajg.2010.265.View ArticlePubMedGoogle Scholar
  37. Wex T, Mönkemüller K, Kuester D, Fry L, Kandulski A, Malfertheiner P: Zonulin is not increased in the cardiac and esophageal mucosa of patients with gastroesophageal reflux disease. Peptides. 2009, 30: 1082-1087. 10.1016/j.peptides.2009.03.017.View ArticlePubMedGoogle Scholar
  38. Wex T, Mönkemüller K, Kuester D, Weise S, Kropf S, Fry LC, Stahr A, Völkel S, Roessner A, Malfertheiner P: Gastroesophageal reflux disease does not lead to changes in the secretory leukocyte protease inhibitor expression in esophageal mucosa. Eur J Gastroenterol Hepatol. 2009, 21: 150-158. 10.1097/MEG.0b013e32830e4905.View ArticlePubMedGoogle Scholar
  39. Wex T, Mönkemüller K, Stahr A, Kuester D, Fry LC, Völkel S, Kandulski A, Roessner A, Malfertheiner P: Gastroesophageal reflux disease is associated with an upregulation of desmosomal components in esophageal mucosa. Histopathology. 2012, 60: 405-415. 10.1111/j.1365-2559.2011.04123.x.View ArticlePubMedGoogle Scholar
  40. Wex T, Treiber G, Lendeckel U, Malfertheiner P: A two-step method for the extraction of high-quality RNA from endoscopic biopsies. Clin Chem Lab Med. 2003, 41: 1033-1037.View ArticlePubMedGoogle Scholar
  41. Schmittgen TD, Livak KJ: Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 2008, 3: 1101-1108. 10.1038/nprot.2008.73.View ArticlePubMedGoogle Scholar
  42. Remmele W, Stegner HE: Recommendation for uniform definition of an immunoreactive score (IRS) for immunohistochemical estrogen receptor detection (ER-ICA) in breast cancer tissue. Pathologe. 1987, 8: 138-140.PubMedGoogle Scholar
  43. Balda MS, Matter K: Tight junctions and the regulation of gene expression. Biochim Biophys Acta. 2009, 1788: 761-767. 10.1016/j.bbamem.2008.11.024.View ArticlePubMedGoogle Scholar
  44. Ichikawa-Tomikawa N, Sugimoto K, Satohisa S, Nishiura K, Chiba H: Possible involvement of tight junctions, extracellular matrix and nuclear receptors in epithelial differentiation. J Biomed Biotechnol. 2011, 2011: 253048-View ArticlePubMedPubMed CentralGoogle Scholar
  45. Cummins PM: Occludin: one protein, many forms. Mol Cell Biol. 2012, 32: 242-250. 10.1128/MCB.06029-11.View ArticlePubMedPubMed CentralGoogle Scholar
  46. Escudero-Esparza A, Jiang WG, Martin TA: The Claudin family and its role in cancer and metastasis. Front Biosci. 2011, 16: 1069-1083. 10.2741/3736.View ArticleGoogle Scholar
  47. Rosenthal R, Milatz S, Krug SM, Oelrich B, Schulzke JD, Amasheh S, Günzel D, Fromm M: Claudin-2, a component of the tight junction, forms a paracellular water channel. J Cell Sci. 2010, 123: 1913-1921. 10.1242/jcs.060665.View ArticlePubMedGoogle Scholar
  48. Fanning AS, Anderson JM: Zonula occludens-1 and −2 are cytosolic scaffolds that regulate the assembly of cellular junctions. Ann N Y Acad Sci. 2009, 1165: 113-120. 10.1111/j.1749-6632.2009.04440.x.View ArticlePubMedPubMed CentralGoogle Scholar
  49. Gonzalez-Mariscal L, Quiros M, Diaz-Coranguez M: ZO proteins and Redox dependent processes. Antioxid Redox Signal. 2011, 15: 1235-1253. 10.1089/ars.2011.3913.View ArticlePubMedGoogle Scholar
  50. Kandulski A, Malfertheiner P: Gastroesophageal reflux disease-from reflux episodes to mucosal inflammation. Nat Rev Gastroenterol Hepatol. 2011, 9: 15-22. 10.1038/nrgastro.2011.210.View ArticlePubMedGoogle Scholar
  51. Rieder F, Biancani P, Harnett K, Yerian L, Falk GW: Inflammatory mediators in gastroesophageal reflux disease: impact on esophageal motility, fibrosis, and carcinogenesis. Am J Physiol Gastrointest Liver Physiol. 2010, 298: G571-G581. 10.1152/ajpgi.00454.2009.View ArticlePubMedPubMed CentralGoogle Scholar
  52. Farré R, van Malenstein H, De Vos R, Geboes K, Depoortere I, Vanden Berghe P, Fornari F, Blondeau K, Mertens V, Tack J, Sifrim D: Short exposure of oesophageal mucosa to bile acids, both in acidic and weakly acidic conditions, can impair mucosal integrity and provoke dilated intercellular spaces. Gut. 2008, 57: 1366-1374. 10.1136/gut.2007.141804.View ArticlePubMedGoogle Scholar
  53. Tobey NA, Hosseini SS, Argote CM, Dobrucali AM, Awayda MS, Orlando RC: Dilated intercellular spaces and shunt permeability in nonerosive acid-damaged esophageal epithelium. Am J Gastroenterol. 2004, 99: 13-22. 10.1046/j.1572-0241.2003.04018.x.View ArticlePubMedGoogle Scholar
  54. Chen X, Oshima T, Tomita T, Fukui H, Watari J, Matsumoto T, Miwa H: Acidic bile salts modulate the squamous epithelial barrier function by modulating tight junction proteins. Am J Physiol Gastrointest Liver Physiol. 2011, 301: G203-G209. 10.1152/ajpgi.00096.2011.View ArticlePubMedGoogle Scholar
  55. Chen X, Oshima T, Shan J, Fukui H, Watari J, Miwa H: Bile salts disrupt human esophageal squamous epithelial barrier function by modulating tight junction proteins. Am J Physiol Gastrointest Liver Physiol. 2012, 303: G199-G208. 10.1152/ajpgi.00454.2011.View ArticlePubMedGoogle Scholar
  56. Suzuki T, Yoshinaga N, Tanabe S: IL-6 regulates claudin-2 expression and tight junction permeability in intestinal epithelium. J Biol Chem. 2011, 286: 31263-31271. 10.1074/jbc.M111.238147.View ArticlePubMedPubMed CentralGoogle Scholar
  57. Li FY, Li Y: Interleukin-6, desmosome and tight junction protein expression levels in reflux esophagitis-affected mucosa. World J Gastroenterol. 2009, 15: 3621-3630. 10.3748/wjg.15.3621.View ArticlePubMedPubMed CentralGoogle Scholar
  58. Rieder F, Cheng L, Harnett KM, Chak A, Cooper GS, Isenberg G, Ray M, Katz JA, Catanzaro A, O'Shea R, Post AB, Wong R, Sivak MV, McCormick T, Phillips M, West GA, Willis JE, Biancani P, Fiocchi C: Gastroesophageal reflux disease-associated esophagitis induces endogenous cytokine production leading to motor abnormalities. Gastroenterology. 2007, 132: 154-165. 10.1053/j.gastro.2006.10.009.View ArticlePubMedGoogle Scholar
  59. Kimura Y, Shiozaki H, Hirao M, Maeno Y, Doki Y, Inoue M, Monden T, Ando-Akatsuka Y, Furuse M, Tsukita S, Monden M: Expression of occludin, tight-junction-associated protein, in human digestive tract. Am J Pathol. 1997, 151: 45-54.PubMedPubMed CentralGoogle Scholar
  60. Halász J, Holczbauer A, Páska C, Kovács M, Benyó G, Verebély T, Schaff Z, Kiss A: Claudin-1 and claudin-2 differentiate fetal and embryonal components in human hepatoblastoma. Hum Pathol. 2006, 37: 555-561. 10.1016/j.humpath.2005.12.015.View ArticlePubMedGoogle Scholar
  61. Resnick MB, Gavilanez M, Newton E, Konkin T, Bhattacharya B, Britt DE, Sabo E, Moss SF: Claudin expression in gastric adenocarcinomas: a tissue microarray study with prognostic correlation. Hum Pathol. 2005, 36: 886-892. 10.1016/j.humpath.2005.05.019.View ArticlePubMedGoogle Scholar
  62. Asaoka D, Miwa H, Hirai S, Ohkawa A, Kurosawa A, Kawabe M, Hojo M, Nagahara A, Minoo T, Ohkura R, Ohkusa T, Sato N: Altered localization and expression of tight-junction proteins in a rat model with chronic acid reflux esophagitis. J Gastroenterol. 2005, 40: 781-790. 10.1007/s00535-005-1628-6.View ArticlePubMedGoogle Scholar
  63. Aijaz S, Balda MS, Matter K: Tight junctions: molecular architecture and function. Int Rev Cytol. 2006, 248: 261-298.View ArticlePubMedGoogle Scholar
  64. Hunfeld NG, Geus WP, Kuipers EJ: Systematic review: rebound acid hypersecretion after therapy with proton pump inhibitors. Aliment Pharmacol Ther. 2007, 25: 39-46.View ArticlePubMedGoogle Scholar
  65. Ikenouchi J, Furuse M, Furuse K, Sasaki H, Tsukita S, Tsukita S: Tricellulin constitutes a novel barrier at tricellular contacts of epithelial cells. J Cell Biol. 2005, 171: 939-945. 10.1083/jcb.200510043.View ArticlePubMedPubMed CentralGoogle Scholar
  66. Pre-publication history

    1. The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-230X/12/128/prepub

Copyright

© Mönkemüller et al.; licensee BioMed Central Ltd. 2012

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.