Skip to main content

Table 1 Primer sequences (5′ to 3′) used for the quantitative polymerase chain reaction

From: Therapeutic effects of different doses of polyethylene glycosylated porcine glucagon-like peptide-2 on ulcerative colitis in male rats

Gene Forward primer Reverse primer
ZO-1 CCATCTTTGGACCGATTGCTG TAATGCCCGAGCTCCGATG
Occludin ACGGTGCCATAGAATGAGATGTTG CAGCTAGTTGTTCATTTCTGCACCA
Claudin-1 CATCGCAGCTACTTGCCAGT TTTTTTTTTTTTTTTTGCAAAAACGA
IL-1 TCAGGAAGGCAGTGTCACTCATTG ACACACTAGCAGGTCGTCATCATC
IL-6 TAGAGTCACAGAAGGAGTGG GCCAGTTCTTCGTAGAGA
IL-7 AACCTCCAAGAAACTACTGCC CACCGATGCATGGTTGCTAAC
IL-10 CTCAGCACTGCTATGCTGCCTGCT TCTTCACCTGCTCCACTGCCTTGC
INF-γ TGTCATCGAATCGCACCT TCAGCACCGACTCCTTTT
TNF-α ACCCCCAACCTATGAAGAAA TCCACGCAAAACGGAATGAA
GADPH CCGAGGGCCCACTAAAGG GCTGTTGAAGTCACAGGAGACAA