Skip to main content

Table 1 Primers sequence list

From: Epithelial to mesenchymal transition in the liver field: the double face of Everolimus in vitro

Human Forward Reverse
  α-SMA GAAGAAGAGGACAGCACTG TCCCATTCCCACCATCAC
  FN GTGTGTTGGGAATGGTCGTG GACGCTTGTGGAATGTGTCG
  VIM AAAACACCCTGCAATCTTTCAGA CACTTTGCGTTCAAGGTCAAGAC
  TGF-β CGTGGAGCTGTACCAGAAAT GATAACCACTCTGGCGAGTC
  GAPDH ACACCCACTCCTCCACCTTT TCCACCACCCTGTTGCTGTA
Rat Forward Reverse
  α-SMA GAAGAAGAGGACAGCACTG TCCCATTCCCACCATCAC
  FN CCAGGCACTGACTACAAGA CATGATACCAGCAAGGACTT
  VIM TGACCGCTTCGCCAACTA CGCAACTCCCTCATCTCCT
  TGF-β ATACGCCTGAGTGGCTGTCT TGGGACTGATCCCATTGATT
  GAPDH TGAGGACCAGGTTGTCTC TCCACCACCCTGTTGCTGTA