Skip to main content

Table 2 Primers for RT-PCR analysis

From: Activation of the prostaglandin D2 metabolic pathway in Crohn’s disease: involvement of the enteric nervous system

Gene Accession number Species Primer sequences (5′-3′)
TNF NM_000594 Homo Sapiens Fw: CGCTCTTCTGCCTGCTGCACT
Rev: ACTGGAGCTGCCCCTCAGCTT
IL1B NM_000576.2 Homo Sapiens Fw: AAAGCTTGGTGATGTCTGGTC
Rev : GGACATGGAGAACACCACTTG
PTGS1 (COX1) NM_000962.2 Homo Sapiens Fw: TCCTGTTGGTGGACTATGG
Rev: GTGGTGGTCCATGTTCCTG
PTGS2 (COX2) NM_000963.2 Homo Sapiens Fw: TGGGAAGCCTTCTCTAACCTC
Rev: TCAGGAAGCTGCTTTTTACCTT
PLA2G4A (cPLA2) NM_024420.2 Homo Sapiens Fw: TGCTACCTACGTTGCTGGTCT
Rev: TTCTCTGGAAAATCAGGGTGA
PTGDS (L-PGDS) NM_000954.5 Homo Sapiens Fw: AGAAGAAGGCGGCGTTGTCC
Rev: CCACCACTGACACGGAGTAGG
HPGDS NM_014485.2 Homo Sapiens Fw: GAGAATGGCTTATTGGTAACTCTGT
Rev: AAAGACCAAAAGTGTGGTACTGC
MRPS6 NM_001010 Human mouse rat Fw: CCAAGCTTATTCAGCGTCTTGTTACTCC
Rev: CCCTCGAGTCCTTCATTCTCTTGGC
PTGDR (DP1) NM_000953 Homo Sapiens Fw: CCTGGAGGAGCGGATCA
Rev: GCTCCATAGTAAGCGCGATAAA
PTGDR2 (DP2) NM_004778 Homo Sapiens Fw: CCTGTGCTCCCTCTGTGC
Rev: TCTGGAGACGGCTCACTG
PPARG NM_138711.3 Homo Sapiens Fw: AAAGTCGTCCTTCCCGCTGACCAAA
Rev: GATGGCCACCTCTTTGCTCTGC
\