Skip to main content

Table 2 Primers used for this study

From: Polymorphisms of PRLHR and HSPA12A and risk of gastric and colorectal cancer in the Chinese Han population

SNP ID 1st – PCR primer sequences 2nd – PCR primer sequences UEP sequences
rs10795668 ACGTTGGATGAATACTTGTACCTTGGTGGG ACGTTGGATGTCATCTATGAGCAGCAGCAG gcGAAAGAGAAAAAGTTAGATTCTTA
rs10788473 ACGTTGGATGCAGGAAGTGACAGCTATCTC ACGTTGGATGGGCTTCATTGGGAGCTAGTG ggggaTCCAAGCTACGGCTCACCTGG
rs1665650 ACGTTGGATGCCAACTGAGGATGATTTGAC ACGTTGGATGGGTTGTTTGGCTACTCAAAG ctccAAATGTCTATCGCCTTTAC
rs12413624 ACGTTGGATGGCTAGGTGTGGCACTGTTTG ACGTTGGATGTTATGCAACTGGTCCTGGTC tgggtTGGTCCTGGTCAGATGTTAT
rs10500715 ACGTTGGATGAGGCTTGAGATTTGGAAGGC ACGTTGGATGCCATCTTTAGATCTTCTCTC cttTTTAGATCTTCTCTCAGTCTA
rs3824999 ACGTTGGATGCTAAATCCCCTTTGCTGGAC ACGTTGGATGGATCAGAGAACTACAAGCAC TTCTCCATTGGTTCTCTAA
rs3802842 ACGTTGGATGCATCGTTTTGTTAGGAAGAC ACGTTGGATGGGCCCCTAAAATGAGGTGAA aagGAGGTGAATTTCTGGGA
  1. PCR polymerase chain reaction, UEP unextended mini-sequencing primer