Skip to main content

Table 1 RT-PCR primer sequences

From: Changes of cytokine levels in a mouse model of post-infectious irritable bowel syndrome

Cytokines Primer sequence
Il1b (94 bp) Forward 5′—ATGGGCAACCACTTACCTATTT—3′
  Reverse 5′—GTTCTAGAGAGTGCTGCCTAATG—3′
Il10 (116 bp) Forward 5′—ACAGCCGGGAAGACAATAAC—3′
  Reverse 5′—CAGCTGGTCCTTTGTTTGAAAG—3′
Il17 (123 bp) Forward 5′—CGCAATGAAGACCCTGATAGAT—3′
  Reverse 5′—CTCTTGCTGGATGAGAACAGAA—3′
Ifng (128 bp) Forward 5′—AAATCCTGCAGAGCCAGATTAT—3′
  Reverse 5′—GCTGTTGCTGAAGAAGGTAGTA—3′
Actb (470 bp) Forward 5′—AGGCTGTGCTGTCCCTGTATG—3′
  Reverse 5′—GAGGTCTTTACGGATGTCAACG—3′