Skip to main content

Table 1 Primers sequence for assessment of gene expression profiles

From: Fast food diet with CCl4 micro-dose induced hepatic-fibrosis –a novel animal model

Gene Sequence
TGFb1 Forward- TGTGTCCAGGCTCCAAATGT
Reverse- AAGGACCTCGGTTGGAAGTG
COL1A1 Forward-TCTCAAGATGGTGGCCGTTA
Reverse-ATCTGCTGGCTCAGGCTCTT
TIMP1 Forward-GGCTCTGAGAAGGGCTACCA
Reverse-TCGAGACCCCAAGGTATTGC
Acta2 Forward- GTCCCAGTTGGTGATGATGC
Reverse- GGGCCAAAAGGACAGCTATG
TNFa Forward- GAAACACACGAGACGCTGAA
Reverse- CAGTCTGGGAAGCTCTGAGG
Osteopontin Forward-CCTGACCCATCTCAGAAGCA
Reverse-GTGGTCATGGCTTTCATTGG
FABP4 Forward-GGCTTCGCCACCAGGAAAG
Reverse-TTCCACGCCCAGTTTGAAGGA