Skip to main content

Table 1 Primer sequences for RT-PCR

From: Liver protective effect of ursodeoxycholic acid includes regulation of ADAM17 activity

  Forward (5′-3′) Reverse (5′-3′)
c-Met ACTTGGCTGCAAGAAACTGTAC TTCACTGGCAGCTTTGCACCTG
CA AGCACTGCCAGCAACAAGTCAG ACGGATTGAAGGAGCCCATCTC
TNFα CCAGGCAGTCAGATCATCTTCG ATCTCTCAGCTCCACGCCATTG
TGFα TTGCTGCCACTCAGAAACAGTG TTGATCTGCCACAGTCCACCTG
iNOS AGCCTTTGGACCTCAGCAAAGC TGCCGAGATTTGAGCCTCATGG
TIMP-1 CTTCTGCAATTCCGACCTCGTC AGGTGGTCTGGTTGACTTCTGG
TIMP-3 CTTCTGCAACTCCGACATCGTG TGGTGAAGCCTCGGTACATCTTC
GAPDH AATCCCATCACCATCTTCCA TGGACTCCACGACGTACTCA