Skip to main content

Table 1 Set of primers used in Real-time quantitative PCR

From: Effect of intracellular lipid accumulation in a new model of non-alcoholic fatty liver disease

Gene name Accession number Forward Reverse
Interleukin L6 NM_000600 ACAGATTTGAGAGTAGTGAGGAAC GGCTGGCATTTGTGGTTGG
Interleukin 8 NM_000584 GACATACTCCAAACCTTTCCAC CTTCTCCACAACCCTCTGC
Tumor necrosis factor alpha NM_000594 GTGAGGAGGACGAACATC GAGCCAGAAGAGGTTGAG
Transforming growth factor beta NM_000660 GCAACAATTCCTGGCGATACC CTCCACGGCTCAACCACTG
Alpha 2 macroglobulin NM_000014 AACCAGGACAAGAGGAAGGAAG AGATAAGCGAGGAGCACATAGG
Vascular endothelial growth factor A NM_003376 TCGCTTACTCTCACCTGCTTC TTCCAACAATGTGTCTCTTCTCTTC
Nerve growth factor NM_002506 AGGAGCAAGCGGTCATCATC TCTGTGGCGGTGGTCTTATC
Connective tissue growth factor NM_001901 CGAGGAGTGGGTGTGTGAC CAGGCAGTTGGCTCTAATCATAG
Thrombospondin 1 NM_003246 ACCAACCGCATTCCAGAGTC CCGCACAGCATCCACCAG
Insulin-like growth factor 2 NM_000612 CGCTGCTACCGCCATCTC GTCCCTCTGACTGCTCTGTG