Skip to main content

Table 2 Primers Designs for qPCR

From: Transcript levels of Toll-Like receptors 5, 8 and 9 correlate with inflammatory activity in Ulcerative Colitis

Gene GENEBANK PRIMERS (5'-3') Amplicon Size (bp) PROBE UPL
TLR1 NM_003263.3 CCTAGCAGTTATCACAAGCTCAAA 70 #79
   TCTTTTCCTTGGGCCATTC   
TLR2 NM_003264.3 CGTTCTCTCAGGTGACTGCTC 66 #14
   TCTCCTTTGGATCCTGCTTG   
TLR3 NM_003265.2 AGTTGTCATCGAATCAAATTAAAGAG 61 #80
   AATCTTCCAATTGCGTGAAAA   
TLR4 NM_138554.2 CTGCGTGAGACCAGAAAGC 75 #33
   TTCAGCTCCATGCATTGATAA   
TLR5 NM_003268.4 GACACAATCTCGGCTGACTG 105 #16
   TCAGGAACATGAACATCAATCTG   
TLR6 NM_006068.2 TGAAACAGTCTCTTTTGSGTAAATGC 72 #55
   CAGAATCCATTTGGGAAAGC   
TLR7 NM_016562.3 CCAGTGTCTAAAGAACCTGGAAA 63 #5
   TCAGGGACAGTGGTCAGTTG   
TLR8 NM_138636.2 AGCACTTCCCTCAGGAAGATT 62 #27
  NM_016610.2 AGCACCTTCAGATGAGGCATA   
TLR9 NM_017442.2 CCAGACCCTCTGGAGAAGC 133 #81
   GTAGGAAGGCAGGCAAGGT   
TOLLIP NM_019009.2 TCCCCGCTGGAATAAGGT 95 #86
   CGTCCATGGAGAAGGCTCT   
TNFA NM_000594.2 CAGCCTCTTCTCCTTCCTGA 123 #29
   GCCAGAGGGCTGATTAGAGA   
IL6 NM_000600 GCCCAGCTATGAACTCCTTCT 86 #45
   GAAGGCAGCAGGCAACAC   
*RPLP0 NM_001002.3 ACAGGGCGACCTGGAAGT 117 #32
  NM_053275.3 GGATCTGCTGCATCTGCTT   
*GADPH NM_002046.3 AGCCACATCGCTCAGACAC 66 #60
   GCCCAATACGACCAAATCC   
ACTB ENST00000331789.2 CAACCGCGAGAAGATGAC 121 560 nm
   GTCCATCACGATGCCAGT   
  1. Note. TLR8, and RPLP0 assays were designed to detect both transcript isoforms, UPL (Universal Probe Library).