Skip to main content

Table 2 qPCR primers and assay conditions.

From: Effect of a multispecies probiotic supplement on quantity of irritable bowel syndrome-related intestinal microbial phylotypes

Assay Primers (5' → 3') Standard Classification of standard ( > 98% unless otherwise stated) Target size (bp) MgCl2
(mM)
Annealing T (°C) Detection T (°C)
Bacteroides intestinalis-like [11] F: AGCATGACCTAGCAATAGGTT
R: CCTTCTCGTTATACTATCCGGTAT
[EMBL:AM277809] Bacteroides 124 3 63 83
Clostridium cocleatum 88% [9] F: AATACATAAGTAACCTGGCRTC
R: CGTAGCACTTTTCATATAGAGTT
[EMBL:AM276544] Erysipelotrichaceae 104 4 60 80
Clostridium thermosuccinogenes 85% [11] F: ACATGCAAGTCGAACGGAAGTC
R: TGCGTCAGAGTTTCCTCCATTG
[EMBL:AM275406] Clostridiales 97% 373 2 62 81
Collinsella aerofaciens-like [9] F: CCCGACGGGAGGGGAT
R: CTTCTGCAGGTACAGTCTTGAC
[EMBL:AM276090] Collinsella 260 4 67 89
Coprococcus eutactus-like [9] F: AGCTTGCTCCGGCYGATTTA
R: CGGTTTTACCAGTCGTTTCCAA
[EMBL:AM275825] Coprococcus 97 2 63 83
Ruminococcus torques 91% [9] F: TGCTTAACTGATCTTCTTCGGA
R: CGGTATTAGCAGTCATTTCTG
[EMBL:AM276624] Lachnospiraceae 119 5 62 82
Ruminococcus torques 93% [11] F: GACTGCTTTTGAAACTGTCA
R: AGGTCCGGTTAAGGA
[EMBL:AM275798] Lachnospiraceae 396 4 61 83
Ruminococcus torques 94% [9] F: AATCTTCGGAGGAAGAGGACA
R: ACACTACACCATGCGGTCCT
[EMBL:AM275522] Lachnospiraceae 137 2 65 85