Skip to main content

Table 1 Primers used in the study

From: Excess fatty acids induce pancreatic acinar cell pyroptosis through macrophage M1 polarization

Gene name Primer sequence
CTSS Forward:5′-TAAGATGGCTGTTTTGGATG
Reverse:5′-TTCTTTTCCCAGATGAGACGC
IL-1β Forward:5′-ATGATGGCTTATTACAGTGGCAA Reverse:5′-GTCGGAGATTCGTAGCTGGA
TNF-α Forward:5′-GAGGCCAAGCCCTGGTATG Reverse:5′-CGGGCCGATTGATCTCAGC
IL-10 Forward:5′-AGAAGGACCAGCTGGACAACAT
Reverse:5′-CAAGTAACCCTTAAAGTCCTGCAGTA
Caspase-1 Forward:5′- TTTCCGCAAGGTTCGATTTTCA
Reverse:5′- GGCATCTGCGCTCTACCATC
Trypsinogen Forward:5′-CATGAATCTACTCCTGATCC
Reverse:5′- TGTCATTGTCCAGAGTCC
GSDMD Forward:5′-CCAGCATG GAAGCCTTAGA G
Reverse:5′-CAGAGTCGAGCACCAGACAC
CD11c Forward:5′-TTC TTC TGC TGT TGG GGT TTG
Reverse:5′-CAA CCA CCA CCC AGG AAC TAT
CD206 Forward:5′-CTACAAGGGATCGGGTTTATGGA Reverse:5′-TTGGCATTGCCTAGTAGCGTA
IRF1 Forward:5′-CCCAAGCTTATGCCCATCACTCGGATGC
Reverse:5′-CCGCTCGAGCTACGGTGCACAGGGAATGG
IRF3 Forward:5′-ACCGACGGCTTTACAGAGAA
Reverse:5′-TCCTCGTCACTGCAGTCTTT
IRF4 Forward:5′-CCATGACAACGCCTTACCCT
Reverse:5′-TTATGCTTGGCTCTGTGGGG
IRF5 Forward:5′-GTTGCCTTTGACGGACCTA
Reverse:5′-GTTGCCTTTGACGGACCTA
IRF7 Forward:5′-ATATCTCACGTGACCGAGGA
Reverse:5′-AGCTGATGGTGCTGGAAGTC
IRF8 Forward:5′-CGAGGTTACGCTGTGCTTTG
Reverse:5′-TTATGCTTGGCTCTGTGGGG
β-actin Forward:5′- GAGACCTTCAACACCCC;
Reverse:5′- GTGGTGGTGAAGCTGTAGCC