Skip to main content

Table 1 Primers used for TM6SF2, PCSK7, and PCSK9 polymorphisms typing

From: Variations in TM6SF2, PCSK9 and PCSK7 genes and risk of hepatic steatosis after liver transplantation: a cross-sectional study

SNP Primer (5′ → 3′) Annealing temperature (°C) Amplicon (bp) Restriction enzyme RFLP fragments (bp)
TM6SF2-rs58542926 F: CCAGGTGTTGTCTCAAGTGG
R: CCAGGTGTTGTCTCAAGTGG
60 247 Hpy188I T allele: 247
C allele: 175 + 71
PCSK7-rs2277287 F: CATTGCCTAGGTATCCGGGT
R: GGGCTTCTCATGTGGCAATC
60 321 PvuII T allele: 321
C allele: 226 + 95
PCSK9-rs505151 F: CACGGTTGTGTCCCAAATGG
R: GAGAGGGACAAGTCGGAACC
60 440 Eam1104I (EarI) G allele: 440
A allele: 290 + 150