Skip to main content

Table 1 VP7 and VP4 consensus and type-specific primers

From: Molecular and serologic characterization of rotavirus from children with acute gastroenteritis in northern Iran, Gorgan

Primer Type Sequence (5′→3′) Position PCR product (bp
Universal primer
 VP7 con1 Forward   ATGTATGGTATTGAATATACCAC 51–71 1014
 VP7 con2 Reverse   GGTCACATCATACAATTCTAATC 1062–1040  
 VP4 con1 Forward   TGGCTTCGCTCATTTATAGACA 2–23 877
 VP4con1 Reverse   ATYTCHGACCAYTTATAHCC 878–859  
G-typing (VP7)
 Gcon Reverse   GGTCACATCATACAATTCT 1062–1044  
 aBT1 G1 CAAGTACTCAAATCAATGATGG 314–335 749
 aCT2 G2 CAATGATATTAACACATTTTCTGTG 411–435 652
 Aust G3 ACGAACTCAACACGAGARG 250–269 813
 aDT4 G4 CGTTTCTGGTGAGGAGTTG 480–498 58
 aAT8 G8 GTCACACCATTTGTAAATTCG 178–198 88
 mG9 G9 CTTGATGTGACTAYAAATAC 757–776 305
P-typing (VP4)
 con3 Forward   TGGCTTCGCTCATTTATAGACA 11–32  
 2 T-1 P [4] CTATTGTTAGAGGTTAGAGTC 474–494 484
 3 T-1 P [6] TGTTGATTAGTTGGATTCAA 259–278 260
 1 T-1 P [8] TCTACTTGGATAACGTGC 339–356 346
 4 T-1 P [9] TGAGACATGCAATTGGAC 385–402 392