Skip to main content

Table 1 Primer sequences for PCR detection of virulence genes

From: Detection of Helicobacter pylori and its virulence genes (cagA, dupA, and vacA) among patients with gastroduodenal diseases in Chris Hani Baragwanath Academic Hospital, South Africa

Target gene Primer pair (5′-3′) Amplicon length (bp) Control strains References
cagA F: ACCGCTCGAGAACCCTAGTCGGTAATGGG
R: CAGGTACCGCGGCCGCTTAAGATTTTTGGAAACCAC
981 J99 [25]
vacAs1/S2 F: ATGGAAATACAACAAACACAC
R: CTGCTTGAATGCGCCAAAC
259/286 J99/Tx30a
vacAm1 F: GGTCAAAATGCGGTCATGG
R: CCATTGGTACCTGTAGAAAC
290 J99
vacAm2 F: CATAACTAGCGCCTTGCAC
R: GGAGCCCCAGGAAACATTG
352 B8
dupA F: GACGATTGAGCGATGGGAATAT
R: CTGAGAAGCCTTATTATCTTGTTGG
971 P12/J99 [26]