Skip to main content

Table 1 Oligo sequences

From: In-depth characterization of the Wnt-signaling/β-catenin pathway in an in vitro model of Barrett’s sequence

Name Forward Reverse Reference Length (bp)
Wnt3a ATGAGCGTGTCACTGCAAAG TGTTGGGCCACAGTATTCCT NM_033131 302
Wnt5a AGAAGAAACTGTGCCACTTGTATCAG CCTTCGATGTCGGAATTGATACT NM_003392 101
Fzd1 ATCGAAGCCAACTCACAGTATTT CACGTTGTTAAGCCCCACG NM_003505 135
Fzd2 GACCAGGTGAGGATCCAGAG AGCTACAAGTTTCTGGGCGA NM_001466 122
Fzd3 TCAAGTCTGGACGACTCATTTG GCATCTGGGAAACAACGTG NM_017412 93
Fzd4 TCTTCTCTGTGCACATTGGC GACAACTTTCACACCGCTCA NM_012193 92
Fzd5 GAGAGACGGTTAGGGCTCG GTGACCCAGGGACGGAG NM_003468 104
Fzd6 ATTCCAGATTTGCGAGAGGA AAAATGGCCTACAACATGACG NM_003506 106
Fzd7 GTCGTGTTTCATGATGGTGC CGCCTCTGTTCGTCTACCTC NM_003507 92
Fzd8 GACACGAAGAGGTAGCAGGC CACCGTCTCCACCTTCCTTA NM_031866 90
Fzd9 AAGTCCATGTTGAGGCGTTC GAAGCTGGAGAAGCTCATGG NM_0035.8 108
Fzd10 CAACCAAGAAAAGCACCACA TATGAGATCCCTGCCCAGTC NM_007197 98
LRP5 GAGATCCTCCGTAGGTCCGT CCAAGCGAGCCTTTCTACAC NM_002335 128
LRP6 AGCGACTTGAACCATCCATT GAGTTGGATCAACCCAGAGC NM_002336 115
Axin2 GCAGATCCGAGAGGATGAAG GGAGTGGTACTGCGAATGGT NM_004655 250
CyclinD1 GGCGGATTGGAAATGAACTT TCCTCTCCAAAATGCCAGAG NM_053056 109
β-Actin CACTCTTCCAGCCTTCCTTC GGTGTAACGCAACTAAGTCATAG NM_001101.3 378