Skip to main content

Table 1 Custom primers used for generation of Illumina DNA libraries

From: Faecal bacterial microbiota in patients with cirrhosis and the effect of lactulose administration

Primer name

Primer nucleotide sequence

V3F

5′-aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct NNNNCCTACGGGAGGCAGCAG-3′

V3R

5′-caagcagaagacggcatacgagatXXXXX gtgactggagttcagacgtgtgctcttccgatctATTACCGCGGCTGCTGG-3′

  1. Lower case letters represent adapter sequences necessary for binding to Illumina flow cell, underlined lowercase letters represent binding site for Illumina sequencing primers, and upper case letters represent V3 region primers (341F on the forward and 518R on the reverse primer). NNNN represents degenerate bases for adding sequence diversity necessary for proper cluster identification by the sequencer, and XXXXXX represents the 6-nucleotide index region for multiplexing
Back to article page

BMC Gastroenterology

ISSN: 1471-230X

Contact us