Skip to main content

Table 1 Information on primers for PCR

From: Anti-fibrogenic effect of PPAR-γ agonists in human intestinal myofibroblasts

Gene forward primer (5’-3’) reverse primer (5’-3’)
Collagen1A1 TAGTCTGTCCTGCGTCCTCT TTATGTTTGGGTCATTTCCA
Fibronectin CTACGGATGACTCGTGCTTT TTCCTTCTGCCACTGTTCTC
α-Smooth muscle actin CTGAGCGTGGCTATTCCTTC GCTGGAAGGTGGACAGAGAG
GAPDH AGGTCGGAGTCAACGGATTTGG ACAGTCTTCTGGGTGGCAGTGATG