Skip to main content

Advertisement

Table 1 Oligonucleotide primers used in this work

From: Synergistic effect of κ-carrageenan on oxazolone-induced inflammation in BALB/c mice

Primers Nucleotide sequence Primer efficiency Positive control Negative control
TLR4-F GCTGCAACTGATGTTCCTTCT 95 % N/A N/A
TLR4-R CCCAACATTCATCCATCTCA
NF-κB-F AAAGCCCTGACAGTCCATTG 93 % N/A N/A
NF-κB-R TTGCTAGACACCGTCTGTGC
FOXp3-F TCGAGCTTCCCAGAGAGAGA 94 % N/A N/A
FOXp3-R GGCCCTGACTGGATGTAAGT
PCNA-F AAGAAGAGGAGGCGGTAA 92 % N/A N/A
PCNA-R AGTGTCCCATGTCAGCAA
β-actin-F TTGCTGACAGGATGCAGAAG 94 % N/A N/A
β-actin-R ACATCTGCTGGAAGGTGGAC
GAPDH-F AATGTGTCCGTCGTGGATCT 93 % N/A N/A
GAPDH-R GGTCCTCAGTGTAGCCCAAG
18S-rRNA-F ATTGGAGCTGGAATTACCGC 95 % N/A N/A
18S-rRNA-R CGGCTACCACATCCAAGGAA
  1. Notes: N/A indicates no results be detected