Skip to main content

Advertisement

Table 1 Primer sequences used for real-time PCR analysis

From: Deficiency of eNOS exacerbates early-stage NAFLD pathogenesis by changing the fat distribution

Gene Primer sense Primer antisense
SREBP-1c CAGCTATTGGCCTTCCTCAG CCTGGACCATTTTAGCCTCA
PPAR-α GTCCTCAGTGCTTCCAGAGG GGTCACCTACGAGTGGCATT
nNOS TCCTAAATCCAGCCGATCGA TCATGGTTGCCAGGGAAGAC
iNOS AGAGAGATCCGATTTAGAGTCTTGGT TGACCCGTGAAGCCATGAC