Skip to main content

Table 1 Primers for exon-specific sequencing of the STK11 gene

From: Clinical characteristics and STK11 gene mutations in Chinese children with Peutz-Jeghers syndrome

Exon Forward Reverse Base
Exon 1 tccttttggggtttttgttg ctggcacggaggacacag 576
Exon 2 tcccacagcactgtgaactc attgccacaatggctgactt 394
Exon 3 ttcagaggggtggctgag cagaagaatggcgtgaacct 488
Exon 4 gtgtgcctggacttctgtga ccaccatctgccgtatgag 649
Exon 5 gtgtgcctggacttctgtga ccaccatctgccgtatgag 649
Exon 6 ggtgtccttgagtccacagg cagtcctctcaatgcctgct 384
Exon 7 ggagtggagtggcctctgt acaggacactgcccagaga 400
Exon 8 atggctgagcttctgtggtc ctttggggacgtgggatt 471
Exon 9 ggatacacctgggcctgac caaaggccacatggcaac 485