Skip to main content

Table 1 Sequences of primers used for the reaction and methods used

From: Genetic mutations in SPINK1, CFTR, CTRC genes in acute pancreatitis

Gene Method   Primer sequence
CFTR ex10 allele-specific PCR F R M GCAAGTGAATCCTGAGCGTG
TGGGTAGTGTGAAGGGTTCAT
GCACCATTAAAGAAAATATCATTGG
SPINK1 ex3 HRM/capillary sequencing F R TTGCTATGAACTCAAGAATGGAGA
CCGATTTTCAAAACATAACACTG
CTRC ex7 HRM/capillary sequencing F R CTTATGCCCTCCCGGTCTGG
GGACAGCTGTGGAGGCAG
CTRC ex3 HRM/capillary sequencing F R CTGACACACAGCCCTCCC
ATGGCCAGGTCTCAGGGTAT