Skip to main content

Table 1 Primer sequences used for real-time PCR analysis

From: Deficiency of iNOS-derived NO accelerates lipid accumulation-independent liver fibrosis in non-alcoholic steatohepatitis mouse model

Gene Primer sense Primer antisense
SREBP-1c CAGCTATTGGCCTTCCTCAG CCTGGACCATTTTAGCCTCA
ChREBP CCTCACTTCACTGTGCCTCA ACAGGGGTTGTTGTCTCTGG
DGAT2 AGGCCCTATTTGGCTACGTT GATGCCTCCAGACATCAGGT
PPAR-α GTCCTCAGTGCTTCCAGAGG GGTCACCTACGAGTGGCATT
MTP GCCCTAGTCAGGAAGCTGTG CCAGCAGGTACATTGTGGTG
IL-1 CCCGTCCTTAAAGCTGTCTG AATTGGAATCCAGGGGAAAC
TNF-α TATGGCTCAGGGTCCAACTC CTCCCTTTGCAGAACTCAGG
TGF-β TGAGTGGCTGTCTTTTGACG AGCCCTGTATTCCGTCTCCT
PDGF CGTTCACTTCCGGTTCATTT GTGGAGGAGCAGACTGAAGG
TIMP-1 CTGTTGGCTGTGAGGAATGCA TTCAGAGCCTTGGAGGAGCTG
TIMP-2 CACAGACTTCAGCGAATGGA CTTGGGAAGCTTGAGAGTGG
CollagenI GAGCGGAGAGTACTGGATCG GTTCGGGCTGATGTACCAGT