Skip to main content

Table 1 PCR primers used in this study

From: The EPIYA-ABCC motif pattern in CagA of Helicobacter pyloriis associated with peptic ulcer and gastric cancer in Mexican population

Primer name and reference Primer sequence (5′to 3′) Motif amplied Size (bp)
cagAF D008 [9] ACAATGCTAAATTAGACAACTTGAGCGA Constant region of the cagA gene 298
cagAR R008 [9] TTAGAATAATCAACAAACATCACGCCAT  
cag2F [30],[41] GGAACCCTAGTCGGTAATG cagA 3′ variable region 550 to 850
cag4 [30],[41] ATCTTTGAGCTTGTCTATCG
cagA28F [41] TTCTCAAAGGAGCAATTGGC Forward for all EPIYA motifs  
cagA-P1C [41],[42] GTCCTGCTTTCTTTTTATTAACTTKAGC EPIYA-A 264
cagA-P2TA [41],[42] TTTAGCAACTTGAGTATAAATGGG EPIYA-B 306
cagAWest [42] TTTCAAAGGGAAAGGTCCGCC EPIYA-C 501
cagAEast [42] AGAGGGAAGCCTGCTTGATT EPIYA-D 495