Skip to main content

Table 1 Primers sequences

From: Inhibitory effects of astaxanthin on azoxymethane-induced colonic preneoplastic lesions in C57/BL/KsJ-db/dbmice

Target gene Direction Primer sequence (5’-3”)
TNF-α forward TGTCCCTTTCACTCACTGGC
reverse CATCTTTTGGGGGAGTGCCT
IL-1β forward GACTTCACCATGGAACCCGT
reverse GGAGACTGCCCATTCTCGAC
IL-6 forward TCCAGTTGCCTTCTTGGGAC
reverse AGTCTCCTCTCCGGACTTGT
F4/80 forward CTGAACATGCAACCTGCCAC
reverse TTCACAGGATTCGTCCAGGC
CCL2 forward GTGCTGACCCCAAGAAGGAA
reverse GTGCTGAAGACCTTAGGGCA
CXCL2 forward GGAAGCCTGGATCGTACCTG
reverse TGAAAGCCATCCGACTGCAT
GPx1 forward GATCCCCAGAGCGTTACTCG
reverse GTTGTGGAAACTCACACGCC
CAT forward GAAGGACCGTGTTTGGTTGC
reverse CCGCTGGCGCTTTTCTTGTT
SOD1 forward CTTGACCCTGGATTGCAGCC
reverse GTTTCGTGAGGAAGCCAGGA
GAPDH forward GGACCTCATGGCCTACATGG
reverse TAGGGCCTCTCTTGCTCAGT