Skip to main content

Advertisement

Table 2 Primer sequences for quantitative PCR

From: Effect of bone marrow-derived mesenchymal stem cells on hepatic fibrosis in a thioacetamide-induced cirrhotic rat model

Gene Forward/reverse Primer sequence
GAPDH Forward AGCCCAGAACATCATCCCTG
Reverse CACCACCTTCTTGATGTCATC
TGF-β1 Forward CCTGGAAAGGGCTCAACAC
Reverse CAGTTCTTCTCTGTGGAGCTGA
Collagen-1 Forward CATGTTCAGCTTTGTGGACCT
Reverse GCAGCTGACTTCAGGGATGT
α-SMA Forward CGATAGAACACGGCATCATCAC
Reverse GCATAGCCCTCATAGATAGGCA
  1. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; TGF-β1, transforming growth factor-beta 1; collagen-1, type 1 collagen; α-SMA, α-smooth muscle actin.