Skip to main content

Table 1 PCR primers and dispensation sequences for pyrosequencing of 17 SNPs evaluated for association with IM.

From: Genetic factors associated with intestinal metaplasia in a high risk Singapore-Chinese population: a cohort study

  PCR Pyrosequencing
Locus Forward Primer Reverse Primer °C bp Sequencing Primer Dispensation
IL10 -- 1082 A/G CTCAATCAAAGGATCCCCAGAGAC AGGCTGGATAGGAGGTCCCTTACT 60 253 ACACTACTAAGGCTTCTTTG cgagcagta
IL10 -- 819 T/C GGCCAATTTAATCCAAGGTTT TCTGCACTTGCTGAAAGCTTCTTA 60 207 CCTTGTACAGGTCATGTAA gtcgatctc
IL-1B -- 511 T/C CATGAGATTGGCTAGGGTAACAG GCCCTCCCTGTCTGTATTGA 60 230 CAATTGACAGAGAGCTCC atctgagca
MMP2 -- 1306 T/C TTTCATCTCTGGGCCATTGT TGAAGTTCTCCCTGTGACAACC 60 265 TCCCCACCCAGCACT gctgactct
EGF +61 A/G GTCATCCCTGCTTTCCTGTGTG CAGAGCAAGGCAAAGGCTTAGA 60 266 CCCAATCCAAGGGTTGT cagactgac
PTPN11 (int1) A/G TGGACGAATGGCAAATTG GATCAATCCCACCTGAGACAGA 60 182 TTGTCTCTAAAGGACTGTG tgagctcat
NQ01 C609T AACTGCATGGAATTGGTTGACTTA TGGTGTCTCATCCCAAATATTCT 60 191 GTGGCTTCCAAGTCTTA cgatcgtca
STCH rs2242661 AACTCGAATCCTGGACCTGATTAG CTGGCGTTTATAATCAAACCTGTG 65 203 GCGGAAAGAGAAAGG gctagtact
STCH rs1882881 CTATGGAAGGCTGCGAGAAC ACTTCCAGCTACAGGCAACATT 65 213 GAGGCTTTTTCCATCA gcagtcgtg
STCH rs12479 CTTGAAGGACCGTGTTGATGT' GCAAAGGTCTCGGATAACAAAAA 60 312 ATGTTTCAGCACCAT gatagctag
STCH rs9982492 TCGTGCTTACCTTGTTCACATT AGTATGAGCCCTGCCATGA 60 193 CCACTTGTCCTTTAAGTCC actcgactc
SULT1A1 G638A GCCAGATCGCCTCTGAGGT TGGGGGACGGTGGTGTAGT 65 233 CCTGGAGTTTGTGGG tgcgagctc
ADPRT T2285C GATACCTAAGTCGGGGGCTTTC ACAAGCTTTCCAGGAGATCCTAAC 65 262 TGCTCCTCCAGGCCA cagtctgat
HER2 +17ex17 A/G GTCCCTCCCACCCCAAACTA CTGCCGTCGCTTGATGAG 65 145 CCCTCTGACGTCCAT gtcagatct
TP53 C215G TCCCAAGCAATGGATGATTTGA AAGCCCAGACGGAAACCGTAG 60 230 CAGAGGCTGCTCCCC tgcagtgct
FR-a A1314G AAGTGGAGACTGAGGCCCAGA TGACCCCTCCCCACCAAC 60 183 GTGTGGCCTGCTCAA cgagtacga
MTHFR C677T ACTGTCATCCCTATTGGCAGGTTA TCGGTGCATGCCTTCACAA 60 168 GAAGGTGTCTGCGGG cgagtacga