Skip to main content

Table 3 Primers used for RT-PCR analysis

From: Decreased expression of cytochrome P450 protein in non-malignant colonic tissue of patients with colonic adenoma

  Sense primer Antisense primer PCR product (bp) Reference
Histone 3.3 GCGTGCTAGCTGGATGTCTT CCACTGAACTTCTGATTCGC 150 [25].
CYP2C8-19 GCTAAAGTCCAGGAAGAGATTGA TCCTGCTGAGAAAGGCATGAAGT 332 [26].
CYP2E1 AGCACAACTCTGAGATATGG ATAGTCACTGTACTTGAACT 365 [26].
CYP3A4 CCAAGCTATGCTCTTCACCG TCAGGCTCCACTTACGGTGC 324 [27].
CYP3A5 TGTCCAGCAGAAACTGCAAA TTGAAGAAGTCCTTGCGTGTC 472 [27].