Skip to main content

Table 1 HFE C282Y allelic discrimination assay using taqman probes. The primers and probes used to amplify and detect the portion of the HFE gene around codon 282.

From: Hepatocellular carcinoma and the penetrance of HFEC282Y mutations: a cross sectional study

 

Primers and Probes

Concentration

forward primer

ggctggataaccttggctgtac

300 nM

reverse primer

gtcacataccccagatcacaatga

900 nM

mutant probe

fam tgctccacctggtacgtatatctctgct

100 nM

wild type probe

vic ctccacctggcacgtatatctctgct

100 nM