Skip to main content

Table 1 HFE C282Y allelic discrimination assay using taqman probes. The primers and probes used to amplify and detect the portion of the HFE gene around codon 282.

From: Hepatocellular carcinoma and the penetrance of HFEC282Y mutations: a cross sectional study

  Primers and Probes Concentration
forward primer ggctggataaccttggctgtac 300 nM
reverse primer gtcacataccccagatcacaatga 900 nM
mutant probe fam tgctccacctggtacgtatatctctgct 100 nM
wild type probe vic ctccacctggcacgtatatctctgct 100 nM