Skip to main content

Table 1 Primers and probes and annealing temperatures for detection of GST polymorphisms

From: No role for glutathione S-transferase genotypes in Caucasian esophageal squamous cell or adenocarcinoma etiology: an European case–control study

GST Polymorphism protein change Genotypes Primers (forward) probes (wild type) Primer (reverse) probes mutant) Annealing temp. MgCl 2 Conc.
GSTM1 Deletion Wild Type: GSTM1 + 5’-CTC CTG ATT ATG ACA GAA GCC-3’ 5’-CTG GAT TGT AGC AGA TCA TGC-3’ 58°C
Polymorphism Hetero.: GSTM1 +    2.0 mM
  Homoz.: GSTM1 -    
GSTA1 -631 T > G Wild Type: GSTA1 *a/*a 5’-TGT TGA TTG TTT GCC TGA AAT T-3’ 5’-GTT AAA CGC TGT CAC CGT CC-3’ 58.5°C
-567 T > G Hetero.: GSTA1 *a/*b    2.0 mM
-69 C > T, -52 G > A Homoz.: GSTA1 *b/*b    
GSTP1 313 A > G Wild Type: I-105-I 5’-CCT GGT GGA CAT GGT GAA TGA-3’ 5’-AGC CAC CTG AGG GGT AAG-3’ 64°C
105 Ile > Val Hetero.: I-105-V 5 ’- Fam - CGC TGC AAA TAC ATC TCC CTC ATC TAC A - BHQ1 - 3 5 ’- Hex - CGC TGC AAA TAC GTC TCC CTC ATC TAC A - BHQ1 - 3 2.5 mM
  Homoz.: V-105-V    
GSTP1 341 C > T Wild Type: A-114-A 5’- TGGACAGGCAGAATGGAATAGAG -3’ 5’- GGGTCTCAAAAGGCTTCAGTTG -3’ 65°C
114 Ala > Val Hetero.: A-114-V 5 ’- Fam - CATCCTTGCCCGCCTCCTGCCAGA - BHQ1 - 3 5 ’- Hex - CATCCTTGCCCACCTCCTGCCAGA - BHQ1 - 3 3.0 mM
  Homoz.: V-114-V    
GSTT1 Deletion Wild Type: GSTT1 + 5’-TTC CTT ACT GGT CCT CAC ATC TC-3’ 5’-TCA CCG GAT CAT GGC CAG CA-3’ 59.5°C
Polymorphism Hetero.: GSTT1 +    2.0 mM
  Homoz.: GSTT1 -