Skip to main content

Table 1 Primer sequences used for QRT-PCR

From: Role of the ABCG8 19H risk allele in cholesterol absorption and gallstone disease

Fragment Primer Sequence Product size
Exon 9/10 ABCG5 F 5’ – CGCGTAGGTCTCCTTTACCA – 3’ 152
  ABCG5 R 5’ – AGTGCATAGGCCAGCATCAT – 3’  
Exon 10/11 ABCG8 F 5’ – GTGGCTGGTGGTCTTCTGTT – 3’ 84
  ABCG8 R 5’ – CTGAAGAAGGAGGCCATGTG – 3’  
Exon 17/18 NPC1L1 F 5’ – GTGGGGCATCAGTTACAATG – 3’ 166
  NPC1L1 R 5’ – AAACACCGCACTTCCCATAG – 3’  
Exon 4/5 LXRα F 5’ – TCAGGCGGATCTGTTCTTCT – 3’ 213
  LXRα R 5’ – TCAGGCGGATCTGTTCTTCT – 3’  
Exon 7/8 LXRβ F 5’ – TAAGCAAGTGCCTGGTTTCC – 3’ 200
  LXRβ R 5’ – ACTCGAAGATGGGGTTGATG – 3’  
Exon 8/10 HNF1α F 5’ – CACGCCCACCAAGCAGGTCT – 3’ 165
  HNF1α R 5’ – CCAGGCTGCTGGAGGACACTG – 3’  
Exon 9/10 HNF4α F 5’ – ATGCTTCCGGGCTGGC – 3’ 235
  HNF4α R 5’ – TTCGAGTGCTGATCCG – 3’  
Exon 4/5 SREB2 F 5’ – CAGCCTCAGATCATCAAGACA – 3’ 202
  SREB2 R 5’ – CTTTCTCTTGCCCCATCATTA – 3’  
Exon 4/5 PPARδ F 5’ – ATGGAGCAGCCACAGGAGGAAGCC – 3’ 200
  PPARδ R 5’ – GCATGAGGCCCCGTCACAGC – 3’