Skip to main content

Advertisement

Table 2 Primers used for real-time qPCR

From: Abnormal fecal microbiota community and functions in patients with hepatitis B liver cirrhosis as revealed by a metagenomic approach

Target group Primer Sequence (5′-3′) Annealing temperature (°C) Reference
Enterobacteriaceae Eco1457F CATTGACGTTACCCGCAGAAGAAGC 63 [18]
  Eco1652R CTCTACGAGACTCAAGCTTGC   
Veillonella Vei343F A(C/T)CAACCTGCCCTTCAGA 62 [18]
  Vei343F CGTCCCGATTAACAGAGCTT   
Bacteroides Bac566F GGGTTTAAAGGGAGCGTAGG 53 [19]
  Bac692R CTACACCACGAATTCCGCCT   
Clostridium CI-F TACCHRAGGAGGAAGCCAC 54 [20]
  CI-R GTTCTTCCTAATCTCTACGCAT