Skip to main content

Table 1 Primers for RT-PCR analysis

From: Protective effects of N-acetylcysteine on acetic acid-induced colitis in a porcine model

Gene Primers
EGFR Forward 5′- GGCCTCCATGCTTTTGAGAA -3′
Reverse 5′- GACGCTATGTCCAGGCCAA -3′
AR Forward 5′-GAGTACGATAACGAACCGCACA -3′
Reverse 5′-TTTCCACTTTTGCCTCCCTTT -3′
TNF-α Forward 5′- TCCAATGGCAGAGTGGGTATG -3′
Reverse 5′- AGCTGGTTGTCTTTCAGCTTCAC -3′
TLR4 Forward 5′- GCCTTTCTCTCCTGCCTGAG -3′
Reverse 5′- AGCTCCATGCATTGGTAACTAATG -3′
RPL4 Forward 5′- GAGAAACCGTCGCCGAAT -3′
  Reverse 5′- GCCCACCAGGAGCAAGTT -3′
  1. The oligonucleotide primers were designed from pig gene sequences in the GenBank NM-2140075 (for EGFR), NM-214376 (for AR), NM-214022.1 (for TNF-α), AB188301 (for TLR4), and DQ845176 (for RPL4). To avoid amplification of potentially contaminating genomic DNA, the primers were designed to span introns and intron-exon boundaries.