Skip to main content

Advertisement

Table 3 PCR primers used in this study

From: The FLS (Fatty liver Shionogi) mouse reveals local expressions of lipocalin-2, CXCL1 and CXCL9 in the liver with non-alcoholic steatohepatitis

Primer Forward Reverse Tm value (°C) Product size (bp)
Lcn2 CTGTCGCTAGATCAGAAC TGTACCTGAGGATACCTGTGC 60 89
Cxcl1 AGCCACACTCAAGAATGGTCG TTACTTGGGGACACCTTTTAG 60 200
Cxcl9 CCGAGGCACGTCCACTTACA TCTAGGTTTGATCCCGTTC 60 117
β-actin CATCCGTAAAGACCTCTATGCCAAC ATGGAGCCACCGATCCACA 60 171