Skip to main content

Advertisement

Table 3 Primers designed for targeting the mucosal inflammatory cytokine-encoding genes in hamster model

From: The protective effect of recombinant Lactococcus lactis oral vaccine on a Clostridium difficile-infected animal model

Gene Accession no. 5′ to 3′ primer sequence Amplicon size
Gro-1 NM_008176 S: GCCACCCGCTCGCTTCTCTG 282bp
   AS: TTACTTGGGGACACCTTTTA  
APRO X15267 S: GGAAGGCCGTGGTGCTGATGG 412bp
   AS: CCGAAGGAGAAGGGGGAGATG  
ICAM-1 NM_010493 S: GGGCACCCAGCAGAAGTTG 512bp
   AS: CCAGCCGAGGACCATACAGC  
IL-6 NM_031268 S: TTGGGACTGATGCTGGTGACA 205bp
   AS: GTGCATCATCGTTGTTCATACAATC  
MCP-1 NM_012333 S: CCCCACTCACCTGCTGCTACT 352bp
   AS: CACTGTCACACTGGTCACTCCTAC  
  1. S and AS denote the sense and antisense primers, respectively.