Skip to main content

Table 1 Primer sequences, probes and accession numbers of transcripts, used for RT PCR quantification

From: Mitochondrial uncouplers inhibit hepatic stellate cell activation

  Gene Primers sequence (Left primer/Right primer) Probe GenBank accession number Product lenght
18S 5′-aaatcagttatggttcctttggtc-3′/ 55 AY_248756 67
  5′gctctagaattaccacagttatccaa-3′    
PGC1α 5′- cagtcgcaacatgctcaag-3′/ 6 NM_008904 73
  5′- tggggtcatttggtgactct-3′    
Tfam 5′- caaaggatgattcggctcag-3′/ 97 NM_009360 92
  5′- aagctgaatatatgcctgcttttc-3′    
CoxIV 5′- tcactgcgctcgttctgat-3′/ 7 NM_37829.1 67
  5′- cgatcgaaagtatgagggatg-3′    
Ndufs7 5′- gtggtgaccaagctggatg-3′/ 104 NM_029272 67
  5′- cgaaggtcataggccacag-3′    
HO-1 5′- gtcaagcacagggtgacaga-3′/ 4 NM_010442 77
  5′- atcacctgcagctcctcaaa-3′    
Smad6 5′- gttgcaacccctaccacttc -3′/ 70 NM_008542 76
  5′- ggaggagacagccgagaata -3′    
Smad7 5′- acccccatcaccttagtcg -3′/ 63 NM_001042660 75
  5′- gaaaatccattgggtatctgga -3′    
α-SMA 5′-ccagcaccatgaagatcaag-3′/ 58 NM_007392 70
  5′-tggaaggtagacagcgaagc-3′    
Pdgfrβ 5′-tgcagagacctcaaaaggtg-3′/ 63 NM_008809.1 112
  5′- cctgatcttcctcccagaaa-3′    
Procol1a1 5′-acctaagggtaccgctgga-3′/ 19 NM_007742 97
  5′-tccagcttctccatctttgc-3′    
α-SMA* 5′-ctgttccagccatccttcat-3′/   NM_001141945 70
  5′-tcatgatgctgttgtaggtgg-3′    
PROCOL1A1* 5′-gacacagaggtttcagtgg-3′/   NM_000088.3 264
  5′-cacccttagcaccaacag-3′    
18S* 5′-aagacggaccagagcgaaag-3′/   K03432 98
  5′-tcggaactacgacggtatct-3′    
PDGFR-β* 5′-cccttatcatcctcatcatgc-3′/   NM_002609.3 60
  5′-ccttccatcggatctcgtaa-3′    
  1. 18S 18S ribosomal RNA, PGC1 α Peroxisome proliferative activated receptor gamma, coactivator 1α, Tfam Transcription factor A, mitochondrial, CoxIV Cytochrome c oxidase subunit IV, Ndufs7 NADH dehydrogenase (ubiquinone) Fe-S protein 7, HO-1 Heme oxygenase-1, Smad6 MAD homolog 6, Smad7 MAD homolog 7, α-SMA α-smooth muscle actin, Pdgfrβ Platelet-derived growth factor receptor β, Procol1a1 Procollagen 1a1. * primers for human samples.