Skip to main content

Table 1 Primers for quantitative PCR

From: High-dose clevudine impairs mitochondrial function and glucose-stimulated insulin secretion in INS-1E cells

Name   Primer sequence Accession code product size
rat β-actin + ATGGTGGGTATGGGTCAGAA NM_031144.2 100 bp
rat Cox1 + GGAGCAGTATTCGCCATCAT NC_001665 90 bp
rat PGC1a + GGCACATCTGTTCTTCCACA NM_031347.1 110 bp
rat NRF1 + GGACAGCAAGCCATTGTTCT NM_001100708.1 98 bp
rat Tfam + GCTGAGTGGAAGGTGTACAAAG NM_031326.1 85 bp
human β-actin + AAGTTCACAATGTGGCCGAG NM_001101.3 98 bp
human Cox1 + CACACTCCACGGAAGCAATA NC_012920.1 82 bp