Skip to main content

Advertisement

Table 4 Oligonucleotide primers used in this study to amplify Helicobacter spp. gene fragments

From: Prevalence of non Helicobacter pylori species in patients presenting with dyspepsia

Gene Sequence (5' to 3') Amplicon size (bp) Reference
Helicobacter 16S rRNA    
C97 GCT ATG ACG GGT ATC C 400 18
C 98 GAT TTT ACC CCT ACA CCA   
H. pylori glmM    
F GGATAAGCTTTTAGGGGTGTTAGGGG 294 19
R GCTTACTTTCTAACACTAACGCGC   
H. heilmannii ureB   580 14
F GGGCGATAAAGTGCGCTTG   
R CTGGTCAATGAGAGCAGG   
H. felis ure A and B   241 20
F GTG AAG CGA CTA AAG ATA AAC AAT   
R GCA CCAAAT CTA ATT CAT AAG AGC