Skip to main content

Table 1 List of primer sequences for the quantification of specific genes by RT-qPCR in hepatic cell lines and clinical samples tissues

From: Gene and functional up-regulation of the BCRP/ABCG2 transporter in hepatocellular carcinoma

Gene Acc. no. Primer forward Primer reverse Ref.
ABCG2 NM_004827 TATAGCTCAGATCATTGTCACAGTC GTTGGTCGTCAGGAAGAAGAG This study
ABCB1 NM_000927 TGCTCAGACAGGATGTGAGTTG AATTACAGCAAGCCTGGAACC This study
β-actin NM_001101 CGCCGCCAGCTCACCATG CACGATGGAGGGGAAGACGG This study
18S-rRNA NR_003286 TAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG [26]