Skip to main content

Table 2 Characteristics of primers, RT-PCR protocol and antibodies

From: Role of tight junction proteins in gastroesophageal reflux disease

  Primer sequence, length of fragment, annealing temperature Antibody, Company, Antigen retrieval, final dilution
Occludin fw: GGCCATTGCCATTGTACTGGG rv: GGAACCGGCGTGGATTTATAGG 315 bp; 58°C polyclonal rabbit anti-occludin antibody No. 71–1500 (Invitrogen, Carlsbad, CA, USA), Protease-retrieval, Final dilution: 1:50
Claudin-1 fw: ATGGTGGTTGGCATCCTCCTG rv: GGCCTTGGTGTTGGGTAAGAGG 344 bp, 58°C polyclonal rabbit anti-Claudin-1 antibody No. 51–9000, clone JAY.8 (Invitrogen, Carlsbad, CA, USA), EDTA-retrieval, Final dilution: 1:50
Claudin-2 fw: TCTCTTGGCCTCCAACTTGTGGG rv: GCACTGGATGTCACCATCATGGC 259 bp, 60°C polyclonal rabbit anti-Claudin-2 antibody No. 51–6100 (Invitrogen, Carlsbad, CA, USA), EDTA-retrieval, Final dilution: 1:50
ZO-1 fw: TCTGATCATTCCAGGCACTCGC rv: CCACATCTGGTTGCCAACTTGG 225 bp, 58°C polyclonal rabbit anti-ZO-1 antibody No. 61–7300, (Invitrogen, Carlsbad, CA, USA, Protease retrieval, Final dilution: 1:30
ZO-2 fw: AGAGGACACGCCGAGCAGATTG rv: TCCCGACATCATTGCCACCAG 272 bp, 60°C polyclonal rabbit anti-ZO-2 antibody No. 71–1400, (Invitrogen, Carlsbad, CA, USA, EDTA retrieval, Final dilution: 1:150
β-Actin fw: CATGCCATCCTGCGTCTGGACC rv: ACATGGTGGTGCCGCCAGACAG 400 bp, 60°C not performed
Standard protocol 95°C: 15 min; (94°C: 30s, 58°-60°C: 30s, 72°C: 30s) 40 cycles; 72°C: 5 min  
  1. mab: monoclonal antibody, fw: forward, rv: reverse.