Skip to main content

Table 1 Primers for amplification and sequencing of UGT1A

From: Combined effect of regulatory polymorphisms on transcription of UGT1A1 as a cause of Gilbert syndrome

Primer name Sequence (5' to 3') Condition
Amplification of UGT1A1 transcriptional regulatory region for direct sequence
   Amp1-F CACCTCCTCCTTATTCTCTTa fragment 1
   Amp1-R CCTTGAATTTCCAAAATCCCAGA 3 min at 96°C, 35 cycles (20 sec at 96°C, 15 sec at 57°C, 90 sec at 72°C), 5 min at 72°C
   Amp2-F GATACAAGGCAGAACAGAAC fragment 2
   Amp2-R AGGTCACACGGTTACTCTGA 2 min at 94°C, 35 cycles (20 sec at 94°C, 30 sec at 61°C, 70 sec at 72°C), 5 min at 72°C
   Amp3-F TGAGCGCTGAAAATCTCAAC fragment 3
   Amp3-R AGAGAGGAAGAAGGACGACT 3 min at 94°C, 32 cycles (30 sec at 94°C, 45 sec at 59°C, 60 sec at 72°C), 10 min at 72°C
   Amp4-F ACAGGTTTCCATGGCGAAAG fragment 4
   Amp4-R GCTTGCTCAGCATATATCTCTGGGb 2 min at 94°C, 35 cycles (20 sec at 94°C, 30 sec at 61°C, 60 sec at 72°C), 5 min at 72°C
Amplification of proximal and distal regulatory regions from genome DNA for cloning
   Proximal-F1 GACTGCCATCCAGTAGGGCTCACACGTT  
   Proximal-R1 CGCCTTTGCTCCTGCCAGAGGTTCG 2 min at 94°C, 30 cycles (20 sec at 94°C, 5 min at 68°C), 10 min at 68°C
   Distal-F1 GAGATCTGAGTTCTCTTCACCTCCTCCT  
   Distal-R1 GCAGAGCTTCCAAGCTTTTTGAGGCTG 2 min at 94°C, 30 cycles (20 sec at 94°C, 30 sec at 63°C, 2 min at 72°C), 5 min at 72°C
Addition of restriction enzyme site of cloned transcriptional regulatory regions by PCR
(underline: Sac I site on Proximal-F2 and Distal-F2; Xho I site on Proximal-R2)
   Proximal-F2 GAGAGCTCCCTCAGCCCCTAGAGCACCATC  
   Proximal-R2 CTCTCGAGGCGCCTTTGCTCCTGCCAGAGG 2 min at 94°C, 8 cycles (20 sec at 94°C, 30 sec at 60°C, 90 sec at 72°C), 5 min at 72°C
   Distal-F2 GAGAGCTCGAAGGGATTAGTTTAGGACAACCCTCCTTC  
   Distal-R1 GCAGAGCTTCCAAGCTTTTTGAGGCTG 2 min at 94°C, 8 cycles (20 sec at 94°C, 30 sec at 60°C, 90 sec at 72°C), 5 min at 72°C
Sequencing primers for transcriptional regulatory region of UGT1A1
   Seq1-1 TATTCTCTTTTTGACACTGG  
   Seq1-2 GACCAAGGTTCCAGAAGTGGTGGTGA  
   Seq1-3 CAATTACAGGGGATGGTGCTCTAG  
   Seq1-4 CTTCCAATTCTGGCTGCACA 5 min at 96°C, 25 cycles (10 sec at 96°C, 5 sec at 50°C, 4 min at 60°C) c
   Seq1-5 GACGAAGGAATGAAACACAT  
   Amp4-F ACAGGTTTCCATGGCGAAAG  
Sequencing primers for cloned transcriptional regulatory regions
   Seq2-1 TCTGCTGTTGGCTGAATCTG  
   Seq2-2 TATACACACGGCCTGCAAGT  
   Seq2-3 CAGAATGGCTAGAGGGTAAG  
   Seq2-4 ACAGAAACATGTCCAGAGCACTT  
   Seq2-5 TGTCTGATGGTGGCCTACTA  
   Seq2-6 TTGCTGCCCTGCTGTGTG 5 min at 96°C, 25 cycles (10 sec at 96°C, 5 sec at 50°C, 4 min at 60°C) c
   Seq2-7 CATCCAGGTACACAGCAGAA  
   Seq2-8 TCATTCCACTGGCCCAAGAT  
   Seq2-9 GGTTCCCAATCAGGTCCATT  
   Seq2-10 TCACATGCGCTCCAGTGAAT  
Seq1-2, Seq1-4, Amp4-F  
  1. aSugatani et al. [10]bMaruo et al. [15]cYamada et al. [35]