Open Access
Open Peer Review

This article has Open Peer Review reports available.

How does Open Peer Review work?

Genetic factors associated with intestinal metaplasia in a high risk Singapore-Chinese population: a cohort study

  • Feng Zhu1,
  • Marie Loh2,
  • Jeffrey Hill3,
  • Sumarlin Lee2,
  • King Xin Koh2,
  • Kin Wai Lai2,
  • Manuel Salto-Tellez2, 4,
  • Barry Iacopetta5,
  • Khay Guan Yeoh1,
  • Richie Soong2, 4Email author and
  • the Singapore Gastric Cancer Consortium
BMC Gastroenterology20099:76

DOI: 10.1186/1471-230X-9-76

Received: 19 June 2009

Accepted: 13 October 2009

Published: 13 October 2009

Abstract

Background

Intestinal metaplasia (IM) is an important precursor lesion in the development of gastric cancer (GC). The aim of this study was to investigate genetic factors previously linked to GC risk for their possible association with IM. A total of 18 polymorphisms in 14 candidate genes were evaluated in a Singapore-Chinese population at high risk of developing GC.

Methods

Genotype frequencies were compared between individuals presenting with (n = 128) or without (n = 246) IM by both univariate and multivariate analysis.

Results

Carriers of the NQO1 609 T allele showed an association with IM in individuals who were seropositive for Helicobacter pylori (HP+; OR = 2.61, 95%CI: 1.18-5.80, P = .018). The IL-10 819 C allele was also associated with IM in HP+ individuals (OR = 2.32, 95%CI: 1.21-4.43, P = 0.011), while the PTPN11 A allele was associated with IM in HP- individuals (OR = 2.51, 95%CI: 1.16-5.40, P = 0.019), but showed an inverse association in HP+ subjects (OR = 0.46, 95%CI: 0.21-0.99, P = 0.048).

Conclusion

Polymorphisms in NQO1, IL-10 and PTPN11, in combination with HP status, could be used to identify individuals who are more likely to develop IM and therefore GC.

Background

Gastric cancer (GC) is the second leading cause of cancer-related mortality worldwide, with more than 700,000 deaths annually[1]. The late presentation of this disease is the main reason for the high mortality and highlights the importance of early detection[2]. In Japan, mass screening programs began in the 1960's and led to a significant increase in the proportion of GC diagnosed at an early stage from 8% in 1960-1964 to 50% in 1975-1979. However, more cost-effective screening programs that target high risk groups are needed because of the limited resources available in many Asian countries. Positive assessment of Helicobacter pylori (HP) infection can help to identify high risk individuals since this is a proven risk factor for GC[3, 4]. Various genetic factors have also been associated with an increased risk for the development of GC [58]. These polymorphisms could be used in conjunction with HP status and together with dietary and environmental factors to target screening programs towards individuals deemed to be at high risk.

GC is thought to arise via a multi-step pathway that involves intestinal metaplasia (IM) as a precursor lesion[9]. It has been estimated that 0.25-1.1% of IM lesions will progress to GC annually, representing an 18-78-fold increased lifetime risk of developing this disease in comparison to the general population[10, 11]. In the present study, we have investigated a panel of 18 polymorphisms in 14 candidate genes for their association with IM precursor lesions in a Singapore-Chinese population considered to be at increased risk of GC because of age greater than 50 years. These polymorphisms were chosen for study because previous research has shown them to be risk factors for GC. They included SNPs in genes involved in the immune response (IL-1β, IL-10, PTPN11) [1214], folate metabolism (FR-α, MTHFR)[15, 16], cell growth (EGF, HER2) [1719], cell survival (STCH)[20], cell invasion (MMP2)[21] and DNA damage or repair (NQO1, SULT1A1, TP53, ADPRT) [2226].

Methods

Subjects

Subjects were recruited from the Gastric Cancer Epidemiology and Molecular Genetics Program (GCEP). This project is a prospective cohort study aiming to enroll 4,000 Singapore-Chinese subjects aged more than 50 years from four major public hospitals in Singapore (National University Hospital, Tan Tock Seng Hospital, Singapore General Hospital, Changi General Hospital). It offers screening by endoscopy and systematic follow-up for a minimum of 5 years [27]. Chinese subjects older than 50 years of age who met the following criteria were eligible to enroll in the study: (i) symptoms of dyspepsia (ie. bloating, distension, nausea, stomach pain etc), (ii) family history of gastric cancer, or (iii) a medical condition that required them to undergo gastroscopy. They must also be able to attend all study visits assigned to them. Subjects who could not undergo gastroscopy, had a history of stomach cancer or surgery, had a disabling illness, or were unable to provide informed consent were ineligible for the study. Clinical information including demographics, medical history and family history were obtained. Informed consent was obtained from all subjects and the study was approved by the institutional review boards of all hospitals involved. Blood samples from 374 individual subjects collected between April 2004 and December 2006 were used for genotyping in the present study.

Three biopsies from the antrum, body and cardia were collected for histopathological examination during each endoscopic surveillance episode. IM was diagnosed from mucosal biopsies in three locations (antrum, body and cardia) for each subject and by consensus amongst three pathologists according to the updated Sydney System for the classification and grading of gastritis [28]. In cases where H. pylori was identified in biopsies, eradication therapy was administered according to standard clinical guidelines. For 339/374 (91%) individuals, the HP status was determined using the Helicoblot2.1 serology test (Genelabs Diagnostics, Singapore). In individuals where this test was not performed, the HP status was determined from histological examination of biopsies from the antrum, body and cardia, as well as from past medical history. Blood samples (8 mls) were collected into Vacutainer CPT tubes (Becton Dickinson, Franklin Lakes, NJ) and the mononuclear cells isolated and stored at -80°C prior to DNA extraction using Tri-Reagent (MRC Inc, Cincinnati, OH).

Helicoblot2.1 serology test

This serological assay uses a Western Blot nitrocellulose strip containing electrophoretically separated proteins from a bacterial lysate of an ulcer-causing type strain of H. pylori and a recombinant antigen of H. pylori (Genelabs Diagnostics, Singapore). When incubated with diluted serum/plasma, specific antibodies to the various antigens, if present, will bind to the H. pylori antigens on the strip. These bound antibodies appear as dark bands upon reaction with goat anti-human IgG conjugated with alkaline phosphatase and a 5-bromo-4-chloro-2-indolyl-phosphate/nitroblue tetrazolium substrate solution. In order to identify the various bands present, the strip is compared with reference strips of non-reactive (negative) and reactive (positive) controls run concurrently. Determination of H. pylori seropositivity was based on criteria recommended by the kit manufacturer. They consist of (1), 116 kD (CagA) positive band present with one or more of the following bands: 89 kD (VacA), 37 kD, 35 kD, 30 kD (UreA) and 19.5 kD together, or with the current infection marker, (2) the presence of any one band at 89 kD (VacA), 37 kD or 35 kD, with or without current infection marker, or (3) the presence of both 30 kD and 19.5 kD with or without current infection marker.

Selection of gene polymorphism panel

A systematic literature search in PubMed was carried out using the terms "gastric cancer" and "polymorphism". From a total of 78 candidate polymorphisms identified, 18 were found to be significantly associated with the risk of GC and were therefore included in the current investigation of IM.

Genotyping

Table 1 shows the PCR primers, annealing temperatures and product sizes for 17 SNPs investigated in this study by pyroseqeuncing. The 86-bp variable number of tandem repeats (VNTR) polymorphism in ILRN was genotyped using PCR followed by size analysis using gel electrophoresis. The primers and PCR conditions were the same as previously reported[29]. Polymorphisms were recorded in their most commonly used notation for easy cross-referencing. For PCR, 50 ng DNA was amplified in a 25 μl reaction containing 1 × FastStart Reaction Buffer, 2 mM magnesium chloride, 10 μM deoxynucleotide mix, 500 nM each of the forward and reverse primers and 1 unit FastStart Taq Polymerase (Roche Diagnostics, Mannheim, Germany). PCR cycling comprised of 4 minutes at 95°C, followed by 35 cycles of 30 seconds at 95°C, 30 seconds at the appropriate annealing temperature and 30 seconds at 72°C, before conclusion with 7 minutes at 72°C.
Table 1

PCR primers and dispensation sequences for pyrosequencing of 17 SNPs evaluated for association with IM.

 

PCR

Pyrosequencing

Locus

Forward Primer

Reverse Primer

°C

bp

Sequencing Primer

Dispensation

IL10 -- 1082 A/G

CTCAATCAAAGGATCCCCAGAGAC

AGGCTGGATAGGAGGTCCCTTACT

60

253

ACACTACTAAGGCTTCTTTG

cgagcagta

IL10 -- 819 T/C

GGCCAATTTAATCCAAGGTTT

TCTGCACTTGCTGAAAGCTTCTTA

60

207

CCTTGTACAGGTCATGTAA

gtcgatctc

IL-1B -- 511 T/C

CATGAGATTGGCTAGGGTAACAG

GCCCTCCCTGTCTGTATTGA

60

230

CAATTGACAGAGAGCTCC

atctgagca

MMP2 -- 1306 T/C

TTTCATCTCTGGGCCATTGT

TGAAGTTCTCCCTGTGACAACC

60

265

TCCCCACCCAGCACT

gctgactct

EGF +61 A/G

GTCATCCCTGCTTTCCTGTGTG

CAGAGCAAGGCAAAGGCTTAGA

60

266

CCCAATCCAAGGGTTGT

cagactgac

PTPN11 (int1) A/G

TGGACGAATGGCAAATTG

GATCAATCCCACCTGAGACAGA

60

182

TTGTCTCTAAAGGACTGTG

tgagctcat

NQ01 C609T

AACTGCATGGAATTGGTTGACTTA

TGGTGTCTCATCCCAAATATTCT

60

191

GTGGCTTCCAAGTCTTA

cgatcgtca

STCH rs2242661

AACTCGAATCCTGGACCTGATTAG

CTGGCGTTTATAATCAAACCTGTG

65

203

GCGGAAAGAGAAAGG

gctagtact

STCH rs1882881

CTATGGAAGGCTGCGAGAAC

ACTTCCAGCTACAGGCAACATT

65

213

GAGGCTTTTTCCATCA

gcagtcgtg

STCH rs12479

CTTGAAGGACCGTGTTGATGT'

GCAAAGGTCTCGGATAACAAAAA

60

312

ATGTTTCAGCACCAT

gatagctag

STCH rs9982492

TCGTGCTTACCTTGTTCACATT

AGTATGAGCCCTGCCATGA

60

193

CCACTTGTCCTTTAAGTCC

actcgactc

SULT1A1 G638A

GCCAGATCGCCTCTGAGGT

TGGGGGACGGTGGTGTAGT

65

233

CCTGGAGTTTGTGGG

tgcgagctc

ADPRT T2285C

GATACCTAAGTCGGGGGCTTTC

ACAAGCTTTCCAGGAGATCCTAAC

65

262

TGCTCCTCCAGGCCA

cagtctgat

HER2 +17ex17 A/G

GTCCCTCCCACCCCAAACTA

CTGCCGTCGCTTGATGAG

65

145

CCCTCTGACGTCCAT

gtcagatct

TP53 C215G

TCCCAAGCAATGGATGATTTGA

AAGCCCAGACGGAAACCGTAG

60

230

CAGAGGCTGCTCCCC

tgcagtgct

FR-a A1314G

AAGTGGAGACTGAGGCCCAGA

TGACCCCTCCCCACCAAC

60

183

GTGTGGCCTGCTCAA

cgagtacga

MTHFR C677T

ACTGTCATCCCTATTGGCAGGTTA

TCGGTGCATGCCTTCACAA

60

168

GAAGGTGTCTGCGGG

cgagtacga

Pyrosequencing was performed by incubating the PCR products with 3 μl of streptavidin magnetic beads (Amersham Pharmacia Biotech, Uppsala, Sweden) and 1× binding buffer (10 mM Tris-HCl, 2 M NaCl, 1 mM EDTA, 0.1% Tween 20) and mixing for 10 minutes at 37°C. The product mix was then denatured by 5 seconds incubation in 0.2 M NaOH solution and washed in annealing buffer (20 mM Tris-acetate, 2 mM magnesium acetate) for 10 seconds. The single-stranded products were transferred to an annealing buffer containing 15 pmol of the sequencing primer (Table 1) and incubated for 2 minutes at 80°C in a Hybaid Maxi 14 hybridization oven (Thermo Electron, USA). Pyrosequencing was then performed on a PSQ96MA pyrosequencer instrument (Biotage AB, Uppsala, Sweden). Samples that failed to give a genotype result after the first analysis were repeated up to two times. The genotyping success rate varied from 85-99% for the 18 polymorphisms.

Statistics

Univariate analyses were carried out by Pearson's chi-square or the Fisher's exact test to examine for associations between genotype distributions, IM status and clinical factors. As there were more than one polymorphism investigated in IL10 and STCH, the haplotypes were also considered in the analyses. Variables found significantly associated with IM in the univariate analyses for all cases, and HP+ and HP- subgroups were entered in respective multivariate logistic regression models. The analyses were based on the assumption of a dominant genetic model. All statistical analyses were performed using SPSS 16.0 (SPSS Inc., Chicago, IL) software at the 5% significance level. The Woolf test was used to test for homogeneity of OR between two strata. As each polymorphism was tested for association with IM independently, it was not necessary to control for the family-wise error rate. Thus, no adjustment was made for multiple testing.

Results

The characteristics of 374 subjects evaluated in this study are shown in Table 2. A total of 128 were diagnosed with IM and 246 without IM. No significant differences between IM+ and IM- groups were apparent for sex, family history of GC (including 1st degree and 2nd degree relatives), alcohol consumption (at least one unit of wine, beer or liquor per week) or smoking status (at least one cigarette per day for a minimum of one year). IM+ subjects showed a significantly higher incidence of HP infection and were also older (P < 0.05).
Table 2

Characteristics of study subjects in relation to the presence of IM.

 

Total (%)

IM+ (%)

IM- (%)

Subjects

374

128

246

Mean age ± SD (range)

60.5 ± 7.8

62.9 ± 7.8

59.2 ± 7.5

Age 50-59 yrs

190 (51)

48 (38)*

142 (58)*

Age 60-69 yrs

133 (36)

55 (43)

78 (32)

Age ≥70 yrs

51 (13)

25 (19)

26 (10)

Male

207 (55)

72 (56)

135 (55)

Family history of GC

66 (18)

23 (18)

43 (17)

HP infection

191 (51)

84 (66)*

107 (43)*

Drinker

66 (18)

22 (17)

46 (19)

Smoker

90 (24)

30 (23)

60 (24)

Chronic gastritis

290 (78)

115 (90)

175 (71)

Atrophy gastritis

194 (52)

97 (76)

97 (39)

Dysplasia

1 (0.3)

1 (0.8)

0

* P < 0.05

Genotype frequencies for the 18 polymorphisms investigated for association with IM are presented in Table 3. All polymorphisms were in Hardy-Weinberg equilibrium (P > 0.05), with the exception of IL10 -819T/C, NQO1 609C/T and TP53 Arg72Pro. By univariate analysis, the NQO1 609 T allele was the only variant in the overall cohort that was significantly associated with IM (OR = 1.82, 95%CI: 1.05-3.15, P = 0.032). In HP- individuals, only the PTPN11 rs2301756 A allele was significantly associated with IM (OR = 2.51, 95%CI: 1.16-5.40, P = 0.019). Three polymorphisms in HP+ individuals were associated with IM in univariate analysis: the IL-10 819 C allele (OR = 2.32, 95%CI: 1.21-4.43, P = 0.011), NQO1 609 T allele (OR = 2.61, 95%CI: 1.18-5.80, P = 0.018) and PTPN11 A allele (OR = 0.46, 95%CI: 0.21-0.99, P = 0.048). The haplotypes in IL10 and STCH were not significantly associated with IM in overall cohort, HP-, as well as HP+ groups.
Table 3

Distribution of genotype frequencies according to IM and HP infection status

Gene polymorphism

(rs number)

Genotype

IM-

IM+

HP-

HP+

    

IM-

IM+

IM-

IM+

ADPRT Val762Ala

(rs1136410)

TT

71

31

33

9

38

22

 

TC

117

60

64

24

53

36

 

CC

33

16

13

6

20

10

EGF +61A/G

(rs4444903)

AA

22

5

13

1

9

4

 

AG

103

55

54

20

49

35

 

GG

110

58

50

18

60

40

FR-α 1314A/G

(none)

GG

164

95

74

30

90

65

 

GA

74

31

43

12

31

19

 

AA

6

1

5

0

1

1

HER2 Ile/Val

(rs1801200)

AA

174

92

87

32

87

60

 

AG

60

30

29

8

31

22

 

GG

1

1

1

1

0

0

IL1RN 86-bp VNTR

(none)

44

212

101

112

33

100

68

 

24

28

18

9

4

19

14

 

34

1

2

0

2

1

0

 

54

0

1

0

0

0

1

 

22

2

2

0

1

2

1

IL-1β -511C/T

(rs16944)

CC

64

35

33

10

31

25

 

CT

119

62

63

21

56

41

 

TT

48

23

20

10

28

13

IL-10 -819T/C

(rs1800871)

TT

131

55

57

21

74*

34

 

TC

78

46

39

15

39

31

 

CC

22

16

17

3

5

13

IL-10 -1082A/G

(rs1800896)

AA

207

100

98

37

109

63

 

AG

21

14

13

3

8

11

 

GG

2

0

2

0

0

0

MMP2 -1306C/T

(rs243865)

CC

178

79

85

28

93

51

 

CT

46

22

26

8

20

14

 

TT

3

2

2

0

1

2

MTHFR 667C/T

(rs1801133)

CC

132

77

64

23

68

54

 

CT

98

42

50

16

48

26

 

TT

14

7

8

2

6

5

NQO1 609C/T

(rs1800566)

CC

64*

21

27

10

37*

11

 

CT

143

80

78

25

65

55

 

TT

28

22

13

4

5

18

TP53 Arg72Pro

(rs1042522)

CC

45

16

22

7

23

9

 

CG

126

78

66

23

60

55

 

GG

51

26

24

10

27

16

PTPN11 rs2301756

(rs2301756)

GG

175

85

92*

24

83*

61

 

GA

58

28

26

16

32

12

 

AA

4

2

0

1

4

1

STCH rs12479

(rs12479)

GG

102

58

51

20

51

38

 

GA

106

39

52

12

54

27

 

AA

22

15

10

8

12

7

STCH rs1882881

(rs1882881)

AA

58

34

24

13

34

21

 

AC

123

58

67

15

56

43

 

CC

57

31

26

13

31

18

STCH rs2242661

(rs2242661)

AA

69

31

34

12

35

19

 

AG

106

46

52

13

54

33

 

GG

44

26

22

13

22

13

STCH rs9982492

(rs9982492)

CC

85

45

41

15

44

30

 

CT

105

39

53

12

52

27

 

TT

28

18

14

9

14

9

SULT1A1 638G/A

(rs9282861)

GG

221

108

112

33

109

75

 

GA

16

10

6

6

10

4

 

AA

1

0

1

0

0

0

* Bold type denotes significant difference in genotype frequencies

In multivariate analysis that included all cases, HP status and age were significantly associated with IM, while the NQO1 T allele showing borderline association (Table 4). In HP- individuals, the PTPN11 A allele was the only factor associated with IM. However, in HP+ individuals the factors of older age and the NQO1 609 T allele, IL-10 819 C allele and PTPN11 A allele were all significantly associated with IM. These results suggest that HP status is an effect modifier of the association between IM and the PTPN11 A allele (P = 0.002). As it is possible that IM+/HP- cases in this study had prior unrecorded HP infection[30], subgroup analysis on cases with a "revised HP+" status (either HP+/IM-, HP+/IM+ or HP-/IM+) was also performed. Age (OR = 2.10, 95%CI: 1.24-3.56, P = 0.006) and IL-10 -819 C allele (OR = 1.82, 95%CI: 1.07-3.08, P = 0.027) were the only significant variables in this subgroup.
Table 4

Multivariate logistic regression analysis for associations with IM.

 

OR for IM

(95% CI)

P

All cases

  

   HP (positive vs negative)

2.16 (1.35 - 3.45)

0.001

   Age (>60 vs <60 yrs)

2.21 (1.40 - 3.49)

0.001

   NQO1 (CT/TT vs CC)

1.74 (0.99 - 3.06)

0.056

HP- cases

  

   Age (>60 vs <60 yrs)

1.92 (0.92 - 4.00)

0.082

   PTPN11 (GA/AA vs GG)

2.51 (1.16 - 5.40)

0.019

HP+ cases

  

   Age (≥60 vs <60 yrs)

2.19 (1.15 - 4.17)

0.017

   NQO1 (CT/TT vs CC)

2.61 (1.18 - 5.80)

0.018

   IL-10 -819 (TC/CC vs TT)

2.32 (1.21 - 4.43)

0.011

   PTPN11 (GA/AA vs GG)

0.46 (0.21 - 0.99)

0.048

Discussion

In this study, 18 polymorphisms that were previously linked to GC were investigated for possible associations with IM in a Singapore-Chinese population. The assumption was made that IM represents a precursor lesion for the development of GC and hence should have similar genetic risk factors. The cohort evaluated here was considered to be at elevated risk for GC because of the selection of individuals aged >50 years[27]. As expected, older individuals and those demonstrating seropositivity for HP showed a doubling in the frequency of IM (Table 4).

Following univariate analysis, 3 genotypes were found to be associated with IM. The NQO1 609 T allele was associated with IM, particularly in HP+ individuals. The IL-10 -819 C allele was also significantly associated with IM in HP+ cases. Interestingly, the PTPN11 A allele in intron 3 (rs2301756) was associated with increased incidence of IM in HP- individuals but a decreased incidence in HP+ cases. In multivariate analysis, all 3 polymorphisms remained significantly associated with IM, with the exception of the NQO1 609 T allele which was associated with borderline significance in the overall cohort (P = 0.056).

Previous data lends support to our observations. NQO1 (NAD(P)H: quinine oxidoreductase 1) codes for a cytosolic enzyme that protects cells from oxidative damage by preventing the generation of semiquinone free radicals and reactive oxygen species[31]. The C to T substitution at nucleotide 609 in exon 6 results in a change of amino acid from Pro to Ser at codon 187[32]. Whereas the CC homozygous wildtype genotype (Pro/Pro) has full enzymatic activity, the TT genotype (Ser/Ser) completely lacks activity. The NQO1 609 TT genotype has been associated with an increased risk for various tumour types including gastrointestinal and urological cancers [3336]. An increased risk of GC in patients with a family history of upper gastrointestinal cancers was also reported for the NQO1 609 TT genotype in a study on Chinese subjects[22]. Our observation of increased prevalence of IM in carriers of the NQO1 609 T allele concurs with earlier reports on its association with various cancers and can be explained by a decreased activity for the detoxification of environmental and dietary carcinogens.

The NQO1 C609T polymorphism was previously associated with seropositivity to HP in a Japanese study[37], thus raising the possibility that it is an indirect risk factor for IM via association with HP infection. However, we found no association between the NQO1 C609T polymorphism and HP infection in the present cohort (results not shown).

Carriers of the IL-10 -819 C allele express higher mucosal levels of IL-10 (interleukin 10) mRNA and experience colonization with more virulent HP strains[38]. Similar to NQO1 C609T, no association was observed here between the IL-10 T-819C polymorphism and HP infection. The current result showing the IL-10 -819 C allele is associated with IM is at odds with an Italian study that reported the TT genotype was associated with increased risk of IM[29] However, two studies in Chinese and German populations found no associations between IL-10 T-819C and IM[38, 39].

Other common polymorphisms in the IL-1β and TNF-α cytokine genes have been proposed to influence the host response to HP and therefore the risk of developing GC[13, 29, 3842]. The IL-1β C-511T and IL-10 A-1082G polymorphisms were investigated in this cohort, but no significant associations were found with seropositivity to HP or with the presence of IM (Table 3). Previous studies reported the IL-1β -511 T allele increased the risk of IM in some[38, 39], but not all populations[12]. One study found an association between the IL-10 A-1082G polymorphism and IM[12, 43], but 3 other studies did not[12, 29, 39].

PTPN11 (protein tyrosine phosphatase, non-receptor type 11) encodes for SHP-2, a protein tyrosine phosphatase thought to play a key role in intracellular signaling elicited by growth factors and cytokines[44]. Interactions between the HP cagA protein and SHP-2 in gastric epithelial cells are believed to contribute to the development of GC[45] The PTPN11 AA genotype was associated with reduced risk of gastric atrophy in a Japanese population of HP seropositive individuals [14, 30]. In those studies, the assessment of gastric atrophy was done with serology test (pepsinogen levels). The present results on IM in HP seropositive Singapore-Chinese support these earlier observations, although the number of AA genotype individuals (n = 6) did not allow separate evaluation of this group. The diagnosis of IM was based on histology examination. The PTPN11 intron 3 G/A SNP may be in linkage disequilibrium with a coding marker that influences the interaction of SHP-2 with cagA and subsequent downstream signaling. However, its association with increased frequency of IM in HP negative individuals suggests it may play a role independently of this factor.

Conclusion

In summary, we found 3 polymorphisms associated with IM in a Singapore-Chinese population that was at high risk for GC because of older age and seropositivity for HP. The value of these SNPs in facilitating more cost-effective surveillance programs awaits further validation in large, independent cohorts.

Declarations

Acknowledgements

This work was funded in part by the National Medical Research Council of Singapore (NMRC/TCR/001-NUS/2007), Biomedical Research Council of Singapore (BMRC 04/1/21/19/312) and the Singapore Cancer Syndicate (SCS#BU51, SCS#GN015). The authors would like to thank contributors from the Singapore Gastric Cancer Consortium that include Khek Yu HO, Yoshiaki ITO, Christopher JL KHOR, Andrea RAJNAKOVA, Kwong Ming FOCK, Choon Jin OOI, Chung King CHIA, Wee Chian LIM, Wai Keong WONG, Andrew WONG, Ming TEH, Nilesh SHAH, Robert HEWITT, Bow HO, Kee Seng CHIA, Yoon Pin LIM, Jimmy JB SO, Lynette PHAY.

Authors’ Affiliations

(1)
Department of Medicine, National University of Singapore
(2)
Cancer Science Institute of Singapore, National University of Singapore
(3)
Experimental Therapeutics Centre, Agency for Science, Technology and Research (A*STAR)
(4)
Department of Pathology, National University of Singapore
(5)
School of Surgery, The University of Western Australia

References

  1. Parkin DM, Bray F, Ferlay J, Pisani P: Global cancer statistics. CA Cancer J Clin. 2005, 55 (2): 74-108. 10.3322/canjclin.55.2.74.View ArticlePubMedGoogle Scholar
  2. Allum WH, Powell DJ, McConkey CC, Fielding JW: Gastric cancer: a 25-year review. Br J Surg. 1989, 76 (6): 535-540. 10.1002/bjs.1800760604.View ArticlePubMedGoogle Scholar
  3. Shikata K, Doi Y, Yonemoto K, Arima H, Ninomiya T, Kubo M, Tanizaki Y, Matsumoto T, Iida M, Kiyohara Y: Population-based prospective study of the combined influence of cigarette smoking and Helicobacter pylori infection on gastric cancer incidence: the Hisayama Study. Am J Epidemiol. 2008, 168 (12): 1409-1415. 10.1093/aje/kwn276.View ArticlePubMedGoogle Scholar
  4. Sugiyama T: Development of gastric cancer associated with Helicobacter pylori infection. Cancer Chemother Pharmacol. 2004, 54 (Suppl 1): S12-20.PubMedGoogle Scholar
  5. Farinati F, Cardin R, Cassaro M, Bortolami M, Nitti D, Tieppo C, Zaninotto G, Rugge M: Helicobacter pylori, inflammation, oxidative damage and gastric cancer: a morphological, biological and molecular pathway. Eur J Cancer Prev. 2008, 17 (3): 195-200. 10.1097/CEJ.0b013e3282f0bff5.View ArticlePubMedGoogle Scholar
  6. Tahara E: Genetic pathways of two types of gastric cancer. IARC Sci Publ. 2005, 327-349. 157
  7. Kamangar F, Cheng C, Abnet CC, Rabkin CS: Interleukin-1B polymorphisms and gastric cancer risk--a meta-analysis. Cancer Epidemiol Biomarkers Prev. 2006, 15 (10): 1920-1928. 10.1158/1055-9965.EPI-06-0267.View ArticlePubMedGoogle Scholar
  8. Hamajima N, Naito M, Kondo T, Goto Y: Genetic factors involved in the development of Helicobacter pylori-related gastric cancer. Cancer Sci. 2006, 97 (11): 1129-1138. 10.1111/j.1349-7006.2006.00290.x.View ArticlePubMedGoogle Scholar
  9. Correa P: Human gastric carcinogenesis: a multistep and multifactorial process--First American Cancer Society Award Lecture on Cancer Epidemiology and Prevention. Cancer Res. 1992, 52 (24): 6735-6740.PubMedGoogle Scholar
  10. Whiting JL, Sigurdsson A, Rowlands DC, Hallissey MT, Fielding JW: The long term results of endoscopic surveillance of premalignant gastric lesions. Gut. 2002, 50 (3): 378-381. 10.1136/gut.50.3.378.View ArticlePubMedPubMed CentralGoogle Scholar
  11. de Vries AC, van Grieken NC, Looman CW, Casparie MK, de Vries E, Meijer GA, Kuipers EJ: Gastric cancer risk in patients with premalignant gastric lesions: a nationwide cohort study in the Netherlands. Gastroenterology. 2008, 134 (4): 945-952. 10.1053/j.gastro.2008.01.071.View ArticlePubMedGoogle Scholar
  12. Con SA, Con-Wong R, Con-Chin GR, Con-Chin VG, Takeuchi H, Valerin AL, Echandi G, Mena F, Brenes F, Yasuda N, et al: Serum pepsinogen levels, Helicobacter pylori CagA Status, and cytokine gene polymorphisms associated with gastric premalignant lesions in Costa Rica. Cancer Epidemiol Biomarkers Prev. 2007, 16 (12): 2631-2636. 10.1158/1055-9965.EPI-07-0215.View ArticlePubMedGoogle Scholar
  13. Wu MS, Wu CY, Chen CJ, Lin MT, Shun CT, Lin JT: Interleukin-10 genotypes associate with the risk of gastric carcinoma in Taiwanese Chinese. Int J Cancer. 2003, 104 (5): 617-623. 10.1002/ijc.10987.View ArticlePubMedGoogle Scholar
  14. Goto Y, Ando T, Yamamoto K, Tamakoshi A, El-Omar E, Goto H, Hamajima N: Association between serum pepsinogens and polymorphismof PTPN11 encoding SHP-2 among Helicobacter pylori seropositive Japanese. Int J Cancer. 2006, 118 (1): 203-208. 10.1002/ijc.21338.View ArticlePubMedGoogle Scholar
  15. Zhang G, Zhang QY, Miao XP, Lin DX, Lu YY: Polymorphisms and mutations of the folate receptor-alpha gene and risk of gastric cancer in a Chinese population. Int J Mol Med. 2005, 15 (4): 627-632.PubMedGoogle Scholar
  16. Graziano F, Kawakami K, Ruzzo A, Watanabe G, Santini D, Pizzagalli F, Bisonni R, Mari D, Floriani I, Catalano V, et al: Methylenetetrahydrofolate reductase 677C/T gene polymorphism, gastric cancer susceptibility and genomic DNA hypomethylation in an at-risk Italian population. Int J Cancer. 2006, 118 (3): 628-632. 10.1002/ijc.21397.View ArticlePubMedGoogle Scholar
  17. Hamai Y, Matsumura S, Matsusaki K, Kitadai Y, Yoshida K, Yamaguchi Y, Imai K, Nakachi K, Toge T, Yasui W: A single nucleotide polymorphism in the 5' untranslated region of the EGF gene is associated with occurrence and malignant progression of gastric cancer. Pathobiology. 2005, 72 (3): 133-138. 10.1159/000084116.View ArticlePubMedGoogle Scholar
  18. Jin G, Miao R, Deng Y, Hu Z, Zhou Y, Tan Y, Wang J, Hua Z, Ding W, Wang L, et al: Variant genotypes and haplotypes of the epidermal growth factor gene promoter are associated with a decreased risk of gastric cancer in a high-risk Chinese population. Cancer Sci. 2007, 98 (6): 864-868. 10.1111/j.1349-7006.2007.00463.x.View ArticlePubMedGoogle Scholar
  19. Kuraoka K, Matsumura S, Hamai Y, Nakachi K, Imai K, Matsusaki K, Oue N, Ito R, Nakayama H, Yasui W: A single nucleotide polymorphism in the transmembrane domain coding region of HER-2 is associated with development and malignant phenotype of gastric cancer. Int J Cancer. 2003, 107 (4): 593-596. 10.1002/ijc.11450.View ArticlePubMedGoogle Scholar
  20. Aoki M, Yamamoto K, Ohyama S, Yamamura Y, Takenoshita S, Sugano K, Minamoto T, Kitajima M, Sugimura H, Shimada S, et al: A genetic variant in the gene encoding the stress70 protein chaperone family member STCH is associated with gastric cancer in the Japanese population. Biochem Biophys Res Commun. 2005, 335 (2): 566-574.View ArticlePubMedGoogle Scholar
  21. Miao X, Yu C, Tan W, Xiong P, Liang G, Lu W, Lin D: A functional polymorphism in the matrix metalloproteinase-2 gene promoter (-1306C/T) is associated with risk of development but not metastasis of gastric cardia adenocarcinoma. Cancer Res. 2003, 63 (14): 3987-3990.PubMedGoogle Scholar
  22. Zhang J, Schulz WA, Li Y, Wang R, Zotz R, Wen D, Siegel D, Ross D, Gabbert HE, Sarbia M: Association of NAD(P)H: quinone oxidoreductase 1 (NQO1) C609T polymorphism with esophageal squamous cell carcinoma in a German Caucasian and a northern Chinese population. Carcinogenesis. 2003, 24 (5): 905-909. 10.1093/carcin/bgg019.View ArticlePubMedGoogle Scholar
  23. Boccia S, Sayed-Tabatabaei FA, Persiani R, Gianfagna F, Rausei S, Arzani D, La Greca A, D'Ugo D, La Torre G, van Duijn CM, et al: Polymorphisms in metabolic genes, their combination and interaction with tobacco smoke and alcohol consumption and risk of gastric cancer: a case-control study in an Italian population. BMC Cancer. 2007, 7: 206-10.1186/1471-2407-7-206.View ArticlePubMedPubMed CentralGoogle Scholar
  24. Wu MT, Chen MC, Wu DC: Influences of lifestyle habits and p53 codon 72 and p21 codon 31 polymorphisms on gastric cancer risk in Taiwan. Cancer Lett. 2004, 205 (1): 61-68. 10.1016/j.canlet.2003.11.026.View ArticlePubMedGoogle Scholar
  25. Miao X, Zhang X, Zhang L, Guo Y, Hao B, Tan W, He F, Lin D: Adenosine diphosphate ribosyl transferase and x-ray repair cross-complementing 1 polymorphisms in gastric cardia cancer. Gastroenterology. 2006, 131 (2): 420-427. 10.1053/j.gastro.2006.05.050.View ArticlePubMedGoogle Scholar
  26. Zhang Z, Miao XP, Tan W, Guo YL, Zhang XM, Lin DX: [Correlation of genetic polymorphisms in DNA repair genes ADPRT and XRCC1 to risk of gastric cancer]. Ai Zheng. 2006, 25 (1): 7-10.PubMedGoogle Scholar
  27. Leung WK, Wu MS, Kakugawa Y, Kim JJ, Yeoh KG, Goh KL, Wu KC, Wu DC, Sollano J, Kachintorn U, et al: Screening for gastric cancer in Asia: current evidence and practice. Lancet Oncol. 2008, 9 (3): 279-287. 10.1016/S1470-2045(08)70072-X.View ArticlePubMedGoogle Scholar
  28. Dixon MF, Genta RM, Yardley JH, Correa P: Classification and grading of gastritis. The updated Sydney System. International Workshop on the Histopathology of Gastritis, Houston 1994. Am J Surg Pathol. 1996, 20 (10): 1161-1181. 10.1097/00000478-199610000-00001.View ArticlePubMedGoogle Scholar
  29. Zambon CF, Basso D, Navaglia F, Belluco C, Falda A, Fogar P, Greco E, Gallo N, Rugge M, Di Mario F, et al: Pro- and anti-inflammatory cytokines gene polymorphisms and Helicobacter pylori infection: interactions influence outcome. Cytokine. 2005, 29 (4): 141-152. 10.1016/j.cyto.2004.10.013.View ArticlePubMedGoogle Scholar
  30. Hishida A, Matsuo K, Goto Y, Naito M, Wakai K, Tajima K, Hamajima N: Associations of a PTPN11 G/A polymorphism at intron 3 with Helicobactor pylori seropositivity, gastric atrophy and gastric cancer in Japanese. BMC Gastroenterol. 2009, 9: 51-10.1186/1471-230X-9-51.View ArticlePubMedPubMed CentralGoogle Scholar
  31. Winski SL, Koutalos Y, Bentley DL, Ross D: Subcellular localization of NAD(P)H:quinone oxidoreductase 1 in human cancer cells. Cancer Res. 2002, 62 (5): 1420-1424.PubMedGoogle Scholar
  32. Kuehl BL, Paterson JW, Peacock JW, Paterson MC, Rauth AM: Presence of a heterozygous substitution and its relationship to DT-diaphorase activity. Br J Cancer. 1995, 72 (3): 555-561.View ArticlePubMedPubMed CentralGoogle Scholar
  33. Sarbia M, Bitzer M, Siegel D, Ross D, Schulz WA, Zotz RB, Kiel S, Geddert H, Kandemir Y, Walter A, et al: Association between NAD(P)H: quinone oxidoreductase 1 (NQ01) inactivating C609T polymorphism and adenocarcinoma of the upper gastrointestinal tract. Int J Cancer. 2003, 107 (3): 381-386. 10.1002/ijc.11430.View ArticlePubMedGoogle Scholar
  34. Zhang JH, Li Y, Wang R, Geddert H, Guo W, Wen DG, Chen ZF, Wei LZ, Kuang G, He M, et al: NQO1 C609T polymorphism associated with esophageal cancer and gastric cardiac carcinoma in North China. World J Gastroenterol. 2003, 9 (7): 1390-1393.View ArticlePubMedPubMed CentralGoogle Scholar
  35. Lafuente MJ, Casterad X, Trias M, Ascaso C, Molina R, Ballesta A, Zheng S, Wiencke JK, Lafuente A: NAD(P)H:quinone oxidoreductase-dependent risk for colorectal cancer and its association with the presence of K-ras mutations in tumors. Carcinogenesis. 2000, 21 (10): 1813-1819. 10.1093/carcin/21.10.1813.View ArticlePubMedGoogle Scholar
  36. Schulz WA, Krummeck A, Rosinger I, Eickelmann P, Neuhaus C, Ebert T, Schmitz-Drager BJ, Sies H: Increased frequency of a null-allele for NAD(P)H: quinone oxidoreductase in patients with urological malignancies. Pharmacogenetics. 1997, 7 (3): 235-239. 10.1097/00008571-199706000-00008.View ArticlePubMedGoogle Scholar
  37. Goto Y, Hamajima N, Honda H, Matsuo K, Yamamoto K, Tamakoshi A, Ando T, Goto H: Association between Helicobacter pylori seropositivity and NAD(P)H:quinone oxidoreductase 1 (NQO1) C609T polymorphism observed in outpatients and health checkup examinees. Gastric Cancer. 2005, 8 (1): 12-17. 10.1007/s10120-004-0308-1.View ArticlePubMedGoogle Scholar
  38. Rad R, Dossumbekova A, Neu B, Lang R, Bauer S, Saur D, Gerhard M, Prinz C: Cytokine gene polymorphisms influence mucosal cytokine expression, gastric inflammation, and host specific colonisation during Helicobacter pylori infection. Gut. 2004, 53 (8): 1082-1089. 10.1136/gut.2003.029736.View ArticlePubMedPubMed CentralGoogle Scholar
  39. Leung WK, Chan MC, To KF, Man EP, Ng EK, Chu ES, Lau JY, Lin SR, Sung JJ: H. pylori genotypes and cytokine gene polymorphisms influence the development of gastric intestinal metaplasia in a Chinese population. Am J Gastroenterol. 2006, 101 (4): 714-720. 10.1111/j.1572-0241.2006.00560.x.View ArticlePubMedGoogle Scholar
  40. El-Omar EM, Carrington M, Chow WH, McColl KE, Bream JH, Young HA, Herrera J, Lissowska J, Yuan CC, Rothman N, et al: Interleukin-1 polymorphisms associated with increased risk of gastric cancer. Nature. 2000, 404 (6776): 398-402. 10.1038/35006081.View ArticlePubMedGoogle Scholar
  41. Machado JC, Figueiredo C, Canedo P, Pharoah P, Carvalho R, Nabais S, Castro Alves C, Campos ML, Van Doorn LJ, Caldas C, et al: A proinflammatory genetic profile increases the risk for chronic atrophic gastritis and gastric carcinoma. Gastroenterology. 2003, 125 (2): 364-371. 10.1016/S0016-5085(03)00899-0.View ArticlePubMedGoogle Scholar
  42. El-Omar EM, Rabkin CS, Gammon MD, Vaughan TL, Risch HA, Schoenberg JB, Stanford JL, Mayne ST, Goedert J, Blot WJ, et al: Increased risk of noncardia gastric cancer associated with proinflammatory cytokine gene polymorphisms. Gastroenterology. 2003, 124 (5): 1193-1201. 10.1016/S0016-5085(03)00157-4.View ArticlePubMedGoogle Scholar
  43. Kato I, Canzian F, Franceschi S, Plummer M, van Doorn LJ, Lu Y, Gioia-Patricola L, Vivas J, Lopez G, Severson RK, et al: Genetic polymorphisms in anti-inflammatory cytokine signaling and the prevalence of gastric precancerous lesions in Venezuela. Cancer Causes Control. 2006, 17 (9): 1183-1191. 10.1007/s10552-006-0060-4.View ArticlePubMedGoogle Scholar
  44. Neel BG, Gu H, Pao L: The 'Shp'ing news: SH2 domain-containing tyrosine phosphatases in cell signaling. Trends Biochem Sci. 2003, 28 (6): 284-293. 10.1016/S0968-0004(03)00091-4.View ArticlePubMedGoogle Scholar
  45. Higashi H, Tsutsumi R, Muto S, Sugiyama T, Azuma T, Asaka M, Hatakeyama M: SHP-2 tyrosine phosphatase as an intracellular target of Helicobacter pylori CagA protein. Science. 2002, 295 (5555): 683-686. 10.1126/science.1067147.View ArticlePubMedGoogle Scholar
  46. Pre-publication history

    1. The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-230X/9/76/prepub

Copyright

© Zhu et al; licensee BioMed Central Ltd. 2009

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement